ID: 982256538

View in Genome Browser
Species Human (GRCh38)
Location 4:153456757-153456779
Sequence AGCACTTTGGGAGGCCAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 511305
Summary {0: 55360, 1: 145174, 2: 158991, 3: 100124, 4: 51656}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982256538_982256548 -5 Left 982256538 4:153456757-153456779 CCGCCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 982256548 4:153456775-153456797 GTGCTGGGATTACAGGCGTGGGG 0: 959
1: 2662
2: 2620
3: 2506
4: 2234
982256538_982256554 20 Left 982256538 4:153456757-153456779 CCGCCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 982256554 4:153456800-153456822 CCGCGCCCGGCTTTGCGGCGGGG No data
982256538_982256552 19 Left 982256538 4:153456757-153456779 CCGCCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 982256552 4:153456799-153456821 ACCGCGCCCGGCTTTGCGGCGGG No data
982256538_982256550 15 Left 982256538 4:153456757-153456779 CCGCCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 982256550 4:153456795-153456817 GGGCACCGCGCCCGGCTTTGCGG No data
982256538_982256549 7 Left 982256538 4:153456757-153456779 CCGCCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 982256549 4:153456787-153456809 CAGGCGTGGGGCACCGCGCCCGG 0: 2
1: 239
2: 26326
3: 68923
4: 142505
982256538_982256551 18 Left 982256538 4:153456757-153456779 CCGCCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 982256551 4:153456798-153456820 CACCGCGCCCGGCTTTGCGGCGG No data
982256538_982256546 -7 Left 982256538 4:153456757-153456779 CCGCCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 982256546 4:153456773-153456795 AAGTGCTGGGATTACAGGCGTGG 0: 1142
1: 3395
2: 3470
3: 2707
4: 3182
982256538_982256547 -6 Left 982256538 4:153456757-153456779 CCGCCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 982256547 4:153456774-153456796 AGTGCTGGGATTACAGGCGTGGG 0: 1041
1: 3107
2: 3142
3: 2419
4: 2962

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982256538 Original CRISPR AGCACTTTGGGAGGCCAAGG CGG (reversed) Intergenic
Too many off-targets to display for this crispr