ID: 982256542

View in Genome Browser
Species Human (GRCh38)
Location 4:153456766-153456788
Sequence TGTAATCCCAGCACTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1035426
Summary {0: 288135, 1: 266162, 2: 155564, 3: 133776, 4: 191789}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982256542_982256554 11 Left 982256542 4:153456766-153456788 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 982256554 4:153456800-153456822 CCGCGCCCGGCTTTGCGGCGGGG No data
982256542_982256552 10 Left 982256542 4:153456766-153456788 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 982256552 4:153456799-153456821 ACCGCGCCCGGCTTTGCGGCGGG No data
982256542_982256549 -2 Left 982256542 4:153456766-153456788 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 982256549 4:153456787-153456809 CAGGCGTGGGGCACCGCGCCCGG 0: 2
1: 239
2: 26326
3: 68923
4: 142505
982256542_982256551 9 Left 982256542 4:153456766-153456788 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 982256551 4:153456798-153456820 CACCGCGCCCGGCTTTGCGGCGG No data
982256542_982256550 6 Left 982256542 4:153456766-153456788 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 982256550 4:153456795-153456817 GGGCACCGCGCCCGGCTTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982256542 Original CRISPR TGTAATCCCAGCACTTTGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr