ID: 982256544

View in Genome Browser
Species Human (GRCh38)
Location 4:153456769-153456791
Sequence GCCTGTAATCCCAGCACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1038702
Summary {0: 215700, 1: 270647, 2: 186590, 3: 142154, 4: 223611}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982256544_982256550 3 Left 982256544 4:153456769-153456791 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 982256550 4:153456795-153456817 GGGCACCGCGCCCGGCTTTGCGG No data
982256544_982256552 7 Left 982256544 4:153456769-153456791 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 982256552 4:153456799-153456821 ACCGCGCCCGGCTTTGCGGCGGG No data
982256544_982256551 6 Left 982256544 4:153456769-153456791 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 982256551 4:153456798-153456820 CACCGCGCCCGGCTTTGCGGCGG No data
982256544_982256554 8 Left 982256544 4:153456769-153456791 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 982256554 4:153456800-153456822 CCGCGCCCGGCTTTGCGGCGGGG No data
982256544_982256549 -5 Left 982256544 4:153456769-153456791 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 982256549 4:153456787-153456809 CAGGCGTGGGGCACCGCGCCCGG 0: 2
1: 239
2: 26326
3: 68923
4: 142505

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982256544 Original CRISPR GCCTGTAATCCCAGCACTTT GGG (reversed) Intergenic
Too many off-targets to display for this crispr