ID: 982256545

View in Genome Browser
Species Human (GRCh38)
Location 4:153456770-153456792
Sequence CGCCTGTAATCCCAGCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 988408
Summary {0: 121435, 1: 268139, 2: 223994, 3: 153979, 4: 220861}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982256545_982256554 7 Left 982256545 4:153456770-153456792 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 982256554 4:153456800-153456822 CCGCGCCCGGCTTTGCGGCGGGG No data
982256545_982256549 -6 Left 982256545 4:153456770-153456792 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 982256549 4:153456787-153456809 CAGGCGTGGGGCACCGCGCCCGG 0: 2
1: 239
2: 26326
3: 68923
4: 142505
982256545_982256552 6 Left 982256545 4:153456770-153456792 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 982256552 4:153456799-153456821 ACCGCGCCCGGCTTTGCGGCGGG No data
982256545_982256551 5 Left 982256545 4:153456770-153456792 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 982256551 4:153456798-153456820 CACCGCGCCCGGCTTTGCGGCGG No data
982256545_982256550 2 Left 982256545 4:153456770-153456792 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 982256550 4:153456795-153456817 GGGCACCGCGCCCGGCTTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982256545 Original CRISPR CGCCTGTAATCCCAGCACTT TGG (reversed) Intergenic
Too many off-targets to display for this crispr