ID: 982256551

View in Genome Browser
Species Human (GRCh38)
Location 4:153456798-153456820
Sequence CACCGCGCCCGGCTTTGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982256538_982256551 18 Left 982256538 4:153456757-153456779 CCGCCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 982256551 4:153456798-153456820 CACCGCGCCCGGCTTTGCGGCGG No data
982256545_982256551 5 Left 982256545 4:153456770-153456792 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 982256551 4:153456798-153456820 CACCGCGCCCGGCTTTGCGGCGG No data
982256544_982256551 6 Left 982256544 4:153456769-153456791 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 982256551 4:153456798-153456820 CACCGCGCCCGGCTTTGCGGCGG No data
982256537_982256551 22 Left 982256537 4:153456753-153456775 CCATCCGCCTTGGCCTCCCAAAG 0: 711
1: 22335
2: 112806
3: 168357
4: 160463
Right 982256551 4:153456798-153456820 CACCGCGCCCGGCTTTGCGGCGG No data
982256540_982256551 15 Left 982256540 4:153456760-153456782 CCTTGGCCTCCCAAAGTGCTGGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
Right 982256551 4:153456798-153456820 CACCGCGCCCGGCTTTGCGGCGG No data
982256542_982256551 9 Left 982256542 4:153456766-153456788 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 982256551 4:153456798-153456820 CACCGCGCCCGGCTTTGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982256551 Original CRISPR CACCGCGCCCGGCTTTGCGG CGG Intergenic
No off target data available for this crispr