ID: 982261071

View in Genome Browser
Species Human (GRCh38)
Location 4:153494891-153494913
Sequence GGGTGAACACCCGGCAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 103}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982261071_982261073 -5 Left 982261071 4:153494891-153494913 CCTGCTCTGCCGGGTGTTCACCC 0: 1
1: 0
2: 0
3: 21
4: 103
Right 982261073 4:153494909-153494931 CACCCTTTACCTGCGTGATCCGG 0: 1
1: 0
2: 0
3: 6
4: 56
982261071_982261081 11 Left 982261071 4:153494891-153494913 CCTGCTCTGCCGGGTGTTCACCC 0: 1
1: 0
2: 0
3: 21
4: 103
Right 982261081 4:153494925-153494947 GATCCGGGGAAGTGTGAGAGGGG 0: 1
1: 0
2: 0
3: 13
4: 166
982261071_982261086 21 Left 982261071 4:153494891-153494913 CCTGCTCTGCCGGGTGTTCACCC 0: 1
1: 0
2: 0
3: 21
4: 103
Right 982261086 4:153494935-153494957 AGTGTGAGAGGGGTCTGGGGAGG 0: 1
1: 0
2: 2
3: 62
4: 628
982261071_982261085 18 Left 982261071 4:153494891-153494913 CCTGCTCTGCCGGGTGTTCACCC 0: 1
1: 0
2: 0
3: 21
4: 103
Right 982261085 4:153494932-153494954 GGAAGTGTGAGAGGGGTCTGGGG 0: 1
1: 0
2: 6
3: 54
4: 668
982261071_982261076 -3 Left 982261071 4:153494891-153494913 CCTGCTCTGCCGGGTGTTCACCC 0: 1
1: 0
2: 0
3: 21
4: 103
Right 982261076 4:153494911-153494933 CCCTTTACCTGCGTGATCCGGGG 0: 1
1: 0
2: 0
3: 3
4: 56
982261071_982261087 22 Left 982261071 4:153494891-153494913 CCTGCTCTGCCGGGTGTTCACCC 0: 1
1: 0
2: 0
3: 21
4: 103
Right 982261087 4:153494936-153494958 GTGTGAGAGGGGTCTGGGGAGGG 0: 1
1: 1
2: 6
3: 99
4: 865
982261071_982261079 9 Left 982261071 4:153494891-153494913 CCTGCTCTGCCGGGTGTTCACCC 0: 1
1: 0
2: 0
3: 21
4: 103
Right 982261079 4:153494923-153494945 GTGATCCGGGGAAGTGTGAGAGG No data
982261071_982261074 -4 Left 982261071 4:153494891-153494913 CCTGCTCTGCCGGGTGTTCACCC 0: 1
1: 0
2: 0
3: 21
4: 103
Right 982261074 4:153494910-153494932 ACCCTTTACCTGCGTGATCCGGG 0: 1
1: 0
2: 0
3: 9
4: 81
982261071_982261080 10 Left 982261071 4:153494891-153494913 CCTGCTCTGCCGGGTGTTCACCC 0: 1
1: 0
2: 0
3: 21
4: 103
Right 982261080 4:153494924-153494946 TGATCCGGGGAAGTGTGAGAGGG 0: 1
1: 0
2: 0
3: 8
4: 118
982261071_982261088 23 Left 982261071 4:153494891-153494913 CCTGCTCTGCCGGGTGTTCACCC 0: 1
1: 0
2: 0
3: 21
4: 103
Right 982261088 4:153494937-153494959 TGTGAGAGGGGTCTGGGGAGGGG 0: 1
1: 1
2: 9
3: 89
4: 1188
982261071_982261083 16 Left 982261071 4:153494891-153494913 CCTGCTCTGCCGGGTGTTCACCC 0: 1
1: 0
2: 0
3: 21
4: 103
Right 982261083 4:153494930-153494952 GGGGAAGTGTGAGAGGGGTCTGG 0: 1
1: 0
2: 4
3: 58
4: 570
982261071_982261084 17 Left 982261071 4:153494891-153494913 CCTGCTCTGCCGGGTGTTCACCC 0: 1
1: 0
2: 0
3: 21
4: 103
Right 982261084 4:153494931-153494953 GGGAAGTGTGAGAGGGGTCTGGG 0: 1
1: 0
2: 1
3: 43
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982261071 Original CRISPR GGGTGAACACCCGGCAGAGC AGG (reversed) Intronic
901390301 1:8941321-8941343 GGGTTAACTCCTGGCAGAGCAGG + Intergenic
904320638 1:29695748-29695770 GGGTGAGCACTCAGCAGAGAGGG + Intergenic
904410929 1:30324547-30324569 GTGTGGAGACCAGGCAGAGCAGG + Intergenic
904500264 1:30908927-30908949 GGGTGCCCACTCGGCAGCGCGGG - Intergenic
906276705 1:44522242-44522264 CAGTGAACACGCGACAGAGCTGG - Intronic
911144726 1:94541555-94541577 GGGCGAAGACCCAGCCGAGCAGG + Exonic
912722747 1:112033874-112033896 GGCTGGACACCCAGGAGAGCTGG + Intergenic
921032938 1:211349940-211349962 GAGGGAACACAAGGCAGAGCAGG + Intronic
1062981392 10:1725625-1725647 GGGGCAACACCCGAGAGAGCAGG + Intronic
1064007195 10:11708082-11708104 GGGTGAACACCCCGCACACGGGG + Intergenic
1069026720 10:63550445-63550467 GGATGAACACACAGCAGACCTGG + Intronic
1069027725 10:63562023-63562045 GGATGAACACACAGCAGATCTGG + Intronic
1070267023 10:74913464-74913486 GGGTGAACACACAGCACAACAGG - Intronic
1074766012 10:116700609-116700631 GGGAGAACTCCTGGCACAGCAGG + Intronic
1075444007 10:122501181-122501203 GGCTGCATACCTGGCAGAGCGGG + Intronic
1076354146 10:129840085-129840107 CTGTGAACACCAGGCAGAGGTGG + Intronic
1077221549 11:1420252-1420274 GGGGTCACACCCAGCAGAGCAGG - Intronic
1081553773 11:44138759-44138781 TGGTACACACCCGGCAGAGCAGG - Intronic
1084403949 11:68960395-68960417 GGGTGGGCACCTGGCACAGCAGG + Intergenic
1084416515 11:69035805-69035827 GGGTGAAGCCCCGGGAGAGGGGG - Intergenic
1085196751 11:74677233-74677255 GGGTGAGCACCCACCAGGGCTGG + Intergenic
1092185784 12:6477646-6477668 GGGTGAAGCCGCCGCAGAGCTGG - Intergenic
1096123349 12:49102832-49102854 GGGTGAGCTTCCTGCAGAGCTGG - Intronic
1096687824 12:53300410-53300432 GGGTGAAGAACAGGCAGGGCCGG - Intronic
1101568103 12:105928607-105928629 GTGTGATCACCTGGCAGAACAGG + Intergenic
1102884234 12:116509208-116509230 GGGTGAACACCCGACAGCTATGG + Intergenic
1107271040 13:38616231-38616253 GGGTGAAGACAAGGAAGAGCAGG + Intergenic
1110456093 13:75691880-75691902 GGGTGAACACAGTGCAGACCTGG + Intronic
1110672518 13:78198298-78198320 GGAAAAACACACGGCAGAGCAGG - Intergenic
1114526440 14:23369656-23369678 GGTTGAACACCTGGCACAGATGG - Intergenic
1118633801 14:67729267-67729289 GGGAGAAGAGCCGCCAGAGCAGG - Exonic
1122604378 14:102938443-102938465 TGGTTGACACCCGGCAGGGCCGG + Intronic
1128468808 15:67934806-67934828 GGGTGAACACACTTCAGAGATGG + Intergenic
1131695560 15:94874111-94874133 GTGAGGACACCTGGCAGAGCAGG - Intergenic
1132557840 16:580239-580261 GGGTGAACACCAGGTAGTACAGG - Exonic
1133231709 16:4370033-4370055 GGGTGAACACCAGGCAGATGGGG + Intronic
1133940745 16:10307114-10307136 GGGTGAACACACTGAAGTGCTGG - Intergenic
1135568319 16:23529252-23529274 TGGTGAGTACACGGCAGAGCTGG + Intronic
1136024563 16:27461385-27461407 GGGGGAACACACGGCCCAGCCGG + Exonic
1136080058 16:27846322-27846344 GGGTCAACACCCTTCTGAGCAGG - Intronic
1137033986 16:35553069-35553091 GGGTCAGCTCCCGGCAGGGCGGG - Intergenic
1137497582 16:48982676-48982698 GGGTTCACACCTGGCAGAGCAGG - Intergenic
1138681175 16:58684539-58684561 GGGTAAAGGCGCGGCAGAGCTGG + Exonic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146878139 17:36429073-36429095 GCCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1148451104 17:47778339-47778361 GGGTGGCCACGGGGCAGAGCCGG + Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1151821818 17:76500915-76500937 GGGTGAGCACCGGGCGGACCGGG - Intronic
1152258941 17:79256127-79256149 GGGTGCACACCTGGCGGGGCTGG - Intronic
1154323457 18:13372635-13372657 GGGGAAAAACCCTGCAGAGCTGG - Intronic
1163493455 19:17630850-17630872 GGGAGAGCTCCAGGCAGAGCAGG - Intronic
1165091569 19:33390813-33390835 GGGCGAACCAGCGGCAGAGCAGG + Intronic
1165425169 19:35741415-35741437 GGGTGAGGACACGGCAGAGGTGG - Intronic
1166851442 19:45763383-45763405 GGGTCATCACCCGCCACAGCTGG - Exonic
928405460 2:31011087-31011109 GGGTGGACACCCACGAGAGCTGG + Intronic
933475706 2:82787808-82787830 GAGTGAACACCCTGCAGAATGGG + Intergenic
933732507 2:85468133-85468155 GGGTGACCACCAGCCTGAGCAGG - Intergenic
933992264 2:87642354-87642376 GGGTGAAGACCCCACAGAGGAGG + Intergenic
935152386 2:100449593-100449615 GGGAGAAAACCCTGCAGAGGAGG - Intergenic
936301586 2:111308485-111308507 GGGTGAAGACCCCACAGAGGAGG - Intergenic
936462108 2:112721725-112721747 GGGTGGAAACCCCGCAGAGGAGG - Intronic
942311602 2:174661813-174661835 GGGTGACCACCTTGGAGAGCTGG + Intronic
946432890 2:219634996-219635018 GGGATAACACCTGGCAGAGCAGG - Intronic
947232009 2:227897481-227897503 GGGTGAACATCTTGAAGAGCTGG + Intronic
947765321 2:232633920-232633942 GGTTGAAGACCCTGCAGCGCCGG - Exonic
948116846 2:235499656-235499678 GGGTGAGCAACAGGCAGAGAAGG - Intronic
948165874 2:235862126-235862148 GGATGAACACCCAGGACAGCAGG - Intronic
948613096 2:239181818-239181840 GGGAGAACACTCAGAAGAGCTGG + Intronic
1172656980 20:36543407-36543429 GGGTGAACAACAGGCAGAGGAGG + Intronic
1173250496 20:41361940-41361962 AGGTGAAGGCCTGGCAGAGCCGG - Exonic
1179154589 21:38838886-38838908 GGCTGAGCAACCGGGAGAGCAGG - Intergenic
1179428674 21:41303931-41303953 GGGGGAACACACGGCAGGGGAGG + Intergenic
1183735446 22:39642408-39642430 GGGAGCCCACCTGGCAGAGCTGG - Intronic
1184251499 22:43262872-43262894 GGTTGAAGACCAGGCAGAGAGGG + Intronic
1184372902 22:44093978-44094000 GGGTGAACATCCACCAGGGCGGG - Exonic
954436744 3:50500331-50500353 GGTGGAGCACCCGGCTGAGCTGG - Intronic
958542510 3:95497288-95497310 TGGTGAACAGCATGCAGAGCAGG + Intergenic
960923055 3:122767862-122767884 GGGTGAACAGCCTGCAGGGATGG + Intronic
961651061 3:128416867-128416889 GGGTGAGCTCCAGGCATAGCTGG - Intergenic
966695056 3:182781006-182781028 GGGTTAACACTGGGCACAGCAGG - Intergenic
969711805 4:8849021-8849043 GGGTGGAGACCCGGCTGAGGGGG + Intronic
970002021 4:11373491-11373513 GCGTGATGACCCCGCAGAGCTGG - Intergenic
979919368 4:126478847-126478869 GGGGGAACACACGGGTGAGCAGG - Intergenic
982261071 4:153494891-153494913 GGGTGAACACCCGGCAGAGCAGG - Intronic
984845200 4:184102694-184102716 GGGGCAGCACCAGGCAGAGCAGG - Intronic
986483363 5:8211535-8211557 TGCTGGACACCTGGCAGAGCAGG + Intergenic
989195503 5:38712590-38712612 GGGTGAAGAGTCTGCAGAGCAGG + Intergenic
990864318 5:60364115-60364137 GGGTGAATTCCTGGTAGAGCTGG - Intronic
997426353 5:133805251-133805273 GGGTGGACTCCTGGCAGAGTAGG - Intergenic
1001276162 5:170353307-170353329 GGAAGAACTCCCCGCAGAGCAGG - Intergenic
1002345724 5:178546493-178546515 GGGTGCAGACCCTGCAAAGCTGG + Intronic
1002864414 6:1108256-1108278 TGGTGAACACCCTGGAGATCAGG + Intergenic
1003640021 6:7868762-7868784 GCGGGGACACCCGGCTGAGCTGG + Intronic
1005989215 6:30892886-30892908 GGGTTAACACCCACCACAGCTGG + Intronic
1006031304 6:31178501-31178523 GGGTCAACACACGGGAGAGGGGG + Intronic
1006187658 6:32190042-32190064 GGGTGAACCCCCGGGGGAGCCGG - Exonic
1007382346 6:41498929-41498951 GGGTGTACACAGGGCAGAGCTGG - Intergenic
1010554375 6:77260587-77260609 TGGTGAACACATGGCAGAACTGG - Intergenic
1018712756 6:166508433-166508455 GGGGCAGCACCCGGCAGAGGGGG + Intronic
1018715570 6:166530233-166530255 GGGGGCACACTTGGCAGAGCAGG - Intronic
1024922378 7:54572930-54572952 GGGAGAGCACAGGGCAGAGCAGG + Intergenic
1029496087 7:100895979-100896001 AGGTGGCCACCCGGGAGAGCGGG - Intronic
1032787356 7:135211436-135211458 GCGTGAACCCGCGGAAGAGCAGG + Exonic
1034462725 7:151206859-151206881 GTGTGAACACAGGGCAGAGTGGG + Intergenic
1034979052 7:155464373-155464395 GGGTGTGCACACGGCTGAGCTGG + Exonic
1035234586 7:157487994-157488016 GGGAGAGCACACGGGAGAGCCGG + Intergenic
1038614055 8:29076601-29076623 TGGTGAGCACCCTGCTGAGCGGG - Intronic
1047760877 8:127953250-127953272 GGGTGATCTCCCAGCAGATCGGG - Intergenic
1049237161 8:141518177-141518199 CAGTGAACGCCCGGCAGGGCGGG - Intronic
1058273539 9:103007934-103007956 GTGTGATCACCTGGCAGATCAGG - Intronic
1058966422 9:110043141-110043163 GGGTGAAGACCAGGCATAGGAGG - Intronic
1061803878 9:133127632-133127654 GTGGGAACTCCCGGCACAGCGGG + Intronic
1062319885 9:135985725-135985747 GGGTGAACACGAGGCAGCGGAGG + Intergenic
1062569994 9:137180601-137180623 GGGTGCCCCCCAGGCAGAGCAGG + Intronic