ID: 982269356

View in Genome Browser
Species Human (GRCh38)
Location 4:153570657-153570679
Sequence AGTGGTATGGAAGCTGTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 156}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982269353_982269356 -6 Left 982269353 4:153570640-153570662 CCCGGCACTTTTGTGCTAGTGGT 0: 1
1: 0
2: 1
3: 6
4: 106
Right 982269356 4:153570657-153570679 AGTGGTATGGAAGCTGTGTTAGG 0: 1
1: 0
2: 0
3: 15
4: 156
982269349_982269356 12 Left 982269349 4:153570622-153570644 CCCTTGTTTCTGGCATCTCCCGG 0: 1
1: 0
2: 0
3: 12
4: 174
Right 982269356 4:153570657-153570679 AGTGGTATGGAAGCTGTGTTAGG 0: 1
1: 0
2: 0
3: 15
4: 156
982269351_982269356 11 Left 982269351 4:153570623-153570645 CCTTGTTTCTGGCATCTCCCGGC 0: 1
1: 0
2: 0
3: 9
4: 146
Right 982269356 4:153570657-153570679 AGTGGTATGGAAGCTGTGTTAGG 0: 1
1: 0
2: 0
3: 15
4: 156
982269354_982269356 -7 Left 982269354 4:153570641-153570663 CCGGCACTTTTGTGCTAGTGGTA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 982269356 4:153570657-153570679 AGTGGTATGGAAGCTGTGTTAGG 0: 1
1: 0
2: 0
3: 15
4: 156
982269348_982269356 19 Left 982269348 4:153570615-153570637 CCTTGGGCCCTTGTTTCTGGCAT 0: 1
1: 0
2: 1
3: 16
4: 222
Right 982269356 4:153570657-153570679 AGTGGTATGGAAGCTGTGTTAGG 0: 1
1: 0
2: 0
3: 15
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982269356 Original CRISPR AGTGGTATGGAAGCTGTGTT AGG Intronic
901305664 1:8231057-8231079 TGTGAGTTGGAAGCTGTGTTAGG + Intergenic
906636393 1:47413115-47413137 TGTGAGATGGAAGCTGTGGTGGG + Intergenic
908011091 1:59777955-59777977 AGTGGAATGGAGGCTCTGTAAGG - Intergenic
913465461 1:119137584-119137606 AGAAGTATGGATTCTGTGTTTGG + Intronic
917593510 1:176502672-176502694 AGTGCTATGGAAGGTGTGCATGG + Intronic
921931686 1:220759688-220759710 AGTGGGATGGAATCAGTTTTAGG + Intronic
921932826 1:220769271-220769293 AGTGATAAGAAAGCTGTGTGAGG - Intronic
922482098 1:225946171-225946193 AATTGTATGGATGCTGTGTGAGG + Intergenic
923078653 1:230633015-230633037 AGAGATAGGGAAGGTGTGTTAGG + Intergenic
923647101 1:235834863-235834885 ACAGGTATGGAAGGTGTGTTAGG - Intronic
1064347468 10:14545609-14545631 GGTGGTTTGGAAGCTGTGCATGG - Intronic
1066505087 10:36033587-36033609 TGTGATATGTAAACTGTGTTGGG + Intergenic
1068280971 10:54869252-54869274 TGTGGTATGGTAGCTATCTTTGG - Intronic
1068375663 10:56176640-56176662 AGTGGTATGGAATTAGTGTCAGG - Intergenic
1070535587 10:77374956-77374978 AGTTGTATGGAAACTGGTTTAGG - Intronic
1070948728 10:80413855-80413877 AGAGGTGTGGACGCTGTGTATGG + Intronic
1071203710 10:83250567-83250589 AATTGTAGGGAAGCTGTGATTGG - Intergenic
1071230559 10:83580554-83580576 AGGGGTAGGGCAGCTGTGCTGGG + Intergenic
1073481645 10:103789626-103789648 AGTTGTCTGGAAAGTGTGTTGGG - Intronic
1073760995 10:106628622-106628644 AGTGTTAAGGAAACTGTGGTAGG - Intronic
1074757643 10:116637047-116637069 AGTGAAATGGAATTTGTGTTGGG + Intronic
1077559506 11:3249931-3249953 AGTGGTTTGGGAGCTGTGAAAGG - Intergenic
1077565400 11:3295734-3295756 AGTGGTTTGGGAGCTGTGAAAGG - Intergenic
1077751290 11:4973066-4973088 AGTGATTGGGAAACTGTGTTTGG + Intronic
1078444544 11:11394448-11394470 AGTCATAAGGAAGCTTTGTTTGG + Intronic
1079104896 11:17564261-17564283 AGCTGTATGGAAGCTGTCTGAGG - Intronic
1079432000 11:20399628-20399650 TTTGGTATGGAAATTGTGTTGGG + Intronic
1079882625 11:25945213-25945235 AGGGGTAGGGCAGCTGTGCTGGG - Intergenic
1082307568 11:50599998-50600020 AGCAGTTTGGAAACTGTGTTTGG + Intergenic
1084029733 11:66474125-66474147 AGTGGTATGCATGCTATGCTTGG - Intronic
1084545892 11:69814955-69814977 AGTGTCCTGGAAGCTGTGTCTGG - Intronic
1084964577 11:72737974-72737996 AATGTCATGGAAGCTGTGTGAGG + Intronic
1091134205 11:133173786-133173808 ATTGCTATGGAAGCTGGGATGGG - Intronic
1091636679 12:2202536-2202558 ACAGGTATGGAAGTTGTTTTGGG + Intronic
1093688388 12:22082442-22082464 AGTGTGGTGGACGCTGTGTTGGG + Intronic
1094632723 12:32192623-32192645 AGTGCTATGGAAGGAGAGTTTGG + Intronic
1096314702 12:50554244-50554266 AGTGGTATGGAAGCATGGGTGGG - Intronic
1097185670 12:57195098-57195120 TGTGGTAAGGAAGCTGGGATTGG + Exonic
1099644540 12:85335423-85335445 TATGGTATGGAATCTGGGTTTGG + Intergenic
1101325260 12:103709950-103709972 GGAGGTATGGAAGCTGAGTAGGG - Intronic
1106076350 13:26464483-26464505 AGAAGCAGGGAAGCTGTGTTGGG - Intergenic
1107929137 13:45292308-45292330 AGTGGAATGGATGAGGTGTTAGG + Intergenic
1110045377 13:70821951-70821973 AGTAGTATGGAGGCTGTGGCAGG - Intergenic
1112119298 13:96392393-96392415 AGTTGCCTGGAAGCTCTGTTAGG - Intronic
1114689510 14:24567085-24567107 GGTGGTCTGGAAGCTGTGATGGG - Intergenic
1115231297 14:31163489-31163511 AGTGGTTGGGAGGCTGAGTTGGG + Intronic
1117293910 14:54361428-54361450 AGTGGGATGGAAGGAGTGTGAGG + Intergenic
1119410061 14:74424990-74425012 GGGGGTAGGGAAGTTGTGTTGGG + Intronic
1119845924 14:77829832-77829854 GTTGGTATGGGAGCTGAGTTTGG + Intronic
1126166803 15:45660392-45660414 AGTGGTCTGAGAGCTGTGTCAGG + Intronic
1127332457 15:57952237-57952259 AGTGTAATGGAAGCAGTGGTTGG - Intergenic
1128894002 15:71356429-71356451 AGTGGAATGGAAGCTCTTTGAGG + Intronic
1130120832 15:81046225-81046247 AGTGTCATGGAAGCTGTATGAGG - Intronic
1130208023 15:81895897-81895919 AGGGGGATGGAATCTGTATTTGG + Intergenic
1138973036 16:62170082-62170104 AGTGGTGGGGAAGATGTGTTAGG + Intergenic
1140430658 16:74899969-74899991 AATGAAATTGAAGCTGTGTTTGG - Intronic
1140783450 16:78317167-78317189 AGTTGTGTTGAGGCTGTGTTTGG + Intronic
1141274606 16:82575629-82575651 AGTGATTCTGAAGCTGTGTTAGG + Intergenic
1142726583 17:1819443-1819465 AGTATTATGGAAGCTAAGTTTGG + Intronic
1146906904 17:36623775-36623797 AGTGGCTTGGAGCCTGTGTTGGG + Intergenic
1149386982 17:56152133-56152155 AGTACTATGGAAGCTGAGGTTGG + Intronic
1150448400 17:65245373-65245395 AGAGGTAAGGAGACTGTGTTAGG + Intergenic
1153831638 18:8929075-8929097 ACTGGAATGCAAGCTGTGCTTGG - Intergenic
1154323024 18:13369541-13369563 AGTGGAAGGGAGGCAGTGTTCGG + Intronic
1155164218 18:23219581-23219603 AGTGGTCTGGATGCTGAGTGTGG - Intronic
1155339421 18:24799031-24799053 AGTGGTTTGCAAGCTGGGATTGG - Intergenic
1160738137 19:674108-674130 AGTGTTATGGCAGCTGGGGTAGG + Intergenic
1160902020 19:1433485-1433507 CGGGGTGTGGGAGCTGTGTTCGG + Intronic
1165269458 19:34692678-34692700 AGTGGCAGGGAAGCTGAGCTTGG - Intergenic
1165647465 19:37454587-37454609 AGTGATAGGGAAGATGGGTTTGG + Intronic
1168308407 19:55449151-55449173 AGGGGTAGAGAAGCTGTGTGTGG - Intergenic
925660160 2:6193909-6193931 TGTGGTATGGTAGCTGGGTGTGG - Intergenic
926860482 2:17303673-17303695 AGTGGTATGGAAGCTGAACCTGG - Intergenic
927659580 2:24981560-24981582 AGTGGTATGGAATGTCAGTTTGG - Intergenic
927804545 2:26134581-26134603 AGTTGTATGAAACCAGTGTTAGG - Intronic
928274634 2:29889035-29889057 AGTGGTTTTCAAACTGTGTTTGG - Intronic
929822276 2:45283038-45283060 AGTGCTAAGGAAGCTGTTTCTGG + Intergenic
932835306 2:75030630-75030652 AGTGCTAGGGAAGCTGGGATGGG + Intergenic
937651423 2:124323605-124323627 GGTGCTGTGGAAGCTGTGTCAGG - Intronic
939056541 2:137372202-137372224 AGTCTTCTGGAAGCTGAGTTAGG + Intronic
939718314 2:145614212-145614234 AGGAGTATGGAAGGTGTGTTGGG + Intergenic
940250677 2:151672516-151672538 AGGGGTATGGTAGCTGGTTTTGG + Exonic
943458064 2:188132517-188132539 AGTGCTATGCAATCTGTGTTTGG - Intergenic
943748190 2:191484152-191484174 AGTGGTAGGGCTGCTATGTTTGG + Intergenic
945613319 2:212033689-212033711 AGTGGCATGGAAGCCATTTTAGG + Intronic
946838661 2:223797833-223797855 TGTGGTCTGCAAGCTCTGTTTGG + Intronic
947861862 2:233366151-233366173 AGAGGGTTGGAGGCTGTGTTAGG + Intronic
948567905 2:238898070-238898092 AGAGGGCTGGAGGCTGTGTTAGG + Intronic
1169135802 20:3196348-3196370 AGTGCTCTGGAAAATGTGTTGGG - Intronic
1171126338 20:22605226-22605248 AGTGGCATTTAAGCTGGGTTTGG + Intergenic
1173252311 20:41370488-41370510 AGTGGTATGGGGGATGGGTTGGG - Intergenic
1177140264 21:17350807-17350829 AGTGGTATGGTAACTGTGGTAGG - Intergenic
1177929600 21:27264554-27264576 AGGGGTATGGAATCTGTCTGGGG + Intergenic
1179901268 21:44395923-44395945 AGGGGTGTGGAAGCTGTGGAGGG + Intronic
1181509095 22:23380993-23381015 GGTGGTGTGGAAGCGGTGATGGG + Intergenic
1182089968 22:27587798-27587820 AGTGGGATGGAATCTGGGTTTGG - Intergenic
1182368680 22:29795951-29795973 ATTTTTATGGAAGCTCTGTTTGG - Intronic
1182448180 22:30402081-30402103 GATGGTATGGAAGCTTTTTTGGG - Intronic
1182532952 22:30975388-30975410 AGTGGTTTTCAAACTGTGTTCGG - Intergenic
1183135925 22:35887614-35887636 AGTGGTTTGGAAGCAGTATTGGG - Intronic
1183227440 22:36560143-36560165 AGTGCTATCTAAGATGTGTTGGG - Intergenic
1183286414 22:36967188-36967210 AGAGGTCTGGAAGCAGTGCTGGG - Intergenic
1185389494 22:50551212-50551234 GGTGGCATGGCAGCTGTGGTGGG + Exonic
950210811 3:11121656-11121678 AGTGGTATGTAAGCTGGGATGGG + Intergenic
951548944 3:23857680-23857702 TGTGGTTTGGAAGCTGTCTGTGG + Intronic
952330199 3:32357543-32357565 AGTGGTAAGGAAGCTGTGGGTGG + Exonic
953549485 3:43890321-43890343 AGTGGTAGGTAATCTATGTTAGG + Intergenic
956787265 3:72652993-72653015 AATGTTATGGAAGCTGGGTTAGG + Intergenic
957218264 3:77349357-77349379 AGTGGAATGGAAACCGGGTTAGG - Intronic
961493997 3:127277231-127277253 AGCAGCCTGGAAGCTGTGTTGGG + Intergenic
962787047 3:138778260-138778282 AGTGGTATAGAAGGTTTGCTGGG - Intronic
962849532 3:139297715-139297737 ACTGTGATTGAAGCTGTGTTAGG - Intronic
963113776 3:141708426-141708448 AGAGGTTTGTCAGCTGTGTTAGG + Intergenic
968215186 3:196883388-196883410 AGTCTTATGGAAGCTGAGTGGGG + Intronic
970300434 4:14675799-14675821 AGTGCTATGGAAGCTCTGAGGGG - Intergenic
975761431 4:77624265-77624287 AGTGTGATGGAGGCTGTGCTGGG + Intergenic
982269356 4:153570657-153570679 AGTGGTATGGAAGCTGTGTTAGG + Intronic
982618435 4:157672750-157672772 AGTGGAATAGAGGGTGTGTTTGG - Intergenic
984758990 4:183347915-183347937 GGTGGAATGGCAGCTGTATTAGG - Intergenic
985856386 5:2430507-2430529 AGGGGTGTGGGAGCTGTGTGAGG + Intergenic
986236948 5:5919856-5919878 CGTGGTATGGAAGTTGTCTGAGG - Intergenic
987101276 5:14593257-14593279 AGAGGTATGTAAGCAGTGGTTGG + Intronic
987388450 5:17352714-17352736 AGTGCTAAGGAAGCAGTGTTTGG + Intergenic
988520081 5:31937827-31937849 AGTGACTTAGAAGCTGTGTTGGG + Intronic
992614593 5:78536039-78536061 TTTGGTATGGAAGCTGTGACTGG - Intronic
993047725 5:82887356-82887378 AGTGGTGGGGAGGATGTGTTAGG + Intergenic
1001149020 5:169210603-169210625 AGTGGTATGCAGAATGTGTTGGG + Intronic
1001332089 5:170769554-170769576 AGTGTTCTGCAAGCTGTTTTAGG - Intronic
1004067402 6:12262204-12262226 AGTGGTAGGGAAGATGGATTTGG + Intergenic
1004282279 6:14290886-14290908 ACTGGTATGGAAATTGAGTTAGG - Intergenic
1005479142 6:26239113-26239135 AGTGGCATGAAAGCAGTGGTAGG + Intergenic
1010194046 6:73222855-73222877 AGTGGAATGGTAGATGTGTTAGG - Intronic
1010351277 6:74877750-74877772 AGTAGTAAGGAAGCTGTTATTGG + Intergenic
1012779762 6:103542986-103543008 ATTGGAATGGAAGCTGAGGTAGG - Intergenic
1013296328 6:108761272-108761294 AGTGGGATGGGAACTGTGTTAGG - Intergenic
1015177385 6:130325279-130325301 AGAGCTAAGGAAGCTGTGTGAGG + Intronic
1018329062 6:162708511-162708533 AGTGTCATGAAAGCCGTGTTAGG - Intronic
1018488574 6:164268677-164268699 AGTGATGTGGAAACTGTGTGGGG + Intergenic
1018505777 6:164466847-164466869 AGTTGTATGCAAGCCTTGTTGGG - Intergenic
1020440744 7:8214152-8214174 AATGGGATAAAAGCTGTGTTAGG - Intronic
1020472693 7:8557130-8557152 AGAGGTTTAGAACCTGTGTTTGG + Intronic
1021929367 7:25564168-25564190 AGTGGTATAGAATCTGAGTTTGG - Intergenic
1023956937 7:44894072-44894094 AGAGGTTGGGAAGCTGCGTTAGG + Intergenic
1025067252 7:55868020-55868042 AATGGTGTGGCTGCTGTGTTTGG - Intergenic
1025597812 7:62952988-62953010 AGTAGTTTGGAAACTGTTTTGGG + Intergenic
1028021056 7:85773554-85773576 AGAAGTATGCAAGCTGAGTTTGG + Intergenic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1028452196 7:90998506-90998528 AGTTTTATGGAAACTGTGGTAGG + Intronic
1028658121 7:93234203-93234225 AATTGTATGGTAGCTGTGGTTGG + Intronic
1030928663 7:115493562-115493584 GTTGGTATAGAATCTGTGTTTGG + Intergenic
1035033498 7:155880193-155880215 AGTGGAATCCAAGCTGTGTCTGG - Intergenic
1035230084 7:157460067-157460089 GGTGGACTGGAAGCTGGGTTTGG + Intergenic
1035838316 8:2782365-2782387 GATGGTGTGGGAGCTGTGTTGGG - Intergenic
1036084034 8:5593265-5593287 AGTGTTATTGATGATGTGTTGGG + Intergenic
1036735310 8:11309124-11309146 AGTGGGATCCAAGCTGGGTTGGG + Intronic
1038189629 8:25308138-25308160 AGTAGAATGGAGGCTGTATTTGG + Intronic
1040003835 8:42601142-42601164 AGTTTTTTGGAAACTGTGTTAGG + Intergenic
1042687669 8:71460737-71460759 AGTCCTATGGCAGCAGTGTTTGG - Intronic
1047839655 8:128737191-128737213 GATGGAATGGAAACTGTGTTAGG - Intergenic
1051598145 9:18845813-18845835 GCTGGTATGAAAACTGTGTTTGG + Intronic
1055741891 9:79398105-79398127 AGGAGGAAGGAAGCTGTGTTTGG + Intergenic
1057405960 9:94771059-94771081 AGTGGTATGGAAGCTGATGGAGG + Intronic
1057462554 9:95276445-95276467 AGTGGTCTTGAAGATGTGGTAGG - Intronic
1058807821 9:108609396-108609418 CGTGGAGTGGAAGGTGTGTTTGG + Intergenic
1060647090 9:125290204-125290226 AATGGTATGGAAGCTGAGAGGGG + Intronic
1187551420 X:20309761-20309783 AGTGGCATGGAAGCTGCATGGGG - Intergenic
1189237766 X:39501380-39501402 TGTGGGATAGAAGCTGAGTTGGG - Intergenic
1190097438 X:47492954-47492976 AGTGTTATGTTGGCTGTGTTAGG - Intergenic
1197899892 X:131359192-131359214 AGAGTTATGGAAGGAGTGTTAGG - Intronic
1198762987 X:140053229-140053251 AGTGGTGTGTAAGCTCTGTGAGG - Intergenic
1201934713 Y:19396090-19396112 GGTTGTATGGAAGCTGAGTGAGG - Intergenic
1201954042 Y:19601371-19601393 AGAGGTCTGGAAGATCTGTTAGG - Intergenic