ID: 982271699

View in Genome Browser
Species Human (GRCh38)
Location 4:153596485-153596507
Sequence CAGGATGAAGGCTGTGTTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 282}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982271699 Original CRISPR CAGGATGAAGGCTGTGTTGC GGG Intronic
900180968 1:1310793-1310815 GAGGATGACGGCTGTGCTGGTGG + Intronic
900180980 1:1310845-1310867 GAGGATGACGGCTGTGCTGGTGG + Intronic
900180996 1:1310914-1310936 GAGGATGACGGCTGTGCTGGTGG + Exonic
901293850 1:8145689-8145711 CAGGATGAGGGCTCTCTTCCTGG - Intergenic
901742304 1:11350295-11350317 CAGGAGGAGGGCTGGGATGCAGG - Intergenic
902334046 1:15744695-15744717 CAGGACAGAGGCTGTGTGGCGGG + Intronic
902381540 1:16055100-16055122 CACGATGAAGTCTGTGTGTCAGG - Intronic
903118691 1:21199052-21199074 GAGGATGAGGGCTGGGTTGCTGG - Intergenic
903124144 1:21236332-21236354 CAGCATCCAGGCTGTGCTGCCGG + Intronic
903806479 1:26009337-26009359 CAGGAAGAAGGCAGTGGGGCTGG + Intergenic
905536104 1:38723067-38723089 CAGAATGAAGGCTGTGCTGTTGG - Intergenic
907266997 1:53268140-53268162 AAGGATGAAAGCTGAGTTACAGG + Intronic
908292478 1:62682261-62682283 CATGATGAAAGCTGTGTTTTAGG + Intronic
912978203 1:114348531-114348553 CAGGATGAAGGCGGACTTGAAGG + Intergenic
913189463 1:116401161-116401183 GACGAAGAAGGCTGTGTGGCAGG - Exonic
913680215 1:121183384-121183406 GGGAATGAAGGCTGTTTTGCTGG - Exonic
914032049 1:143971036-143971058 GGGAATGAAGGCTGTTTTGCTGG - Exonic
914157396 1:145096931-145096953 GGGAATGAAGGCTGTTTTGCTGG + Exonic
915822427 1:159039178-159039200 CAGGATGAAGGCTATAATACTGG + Intronic
916475285 1:165162998-165163020 CAGGATGCAGGCTCTGGTGCCGG - Intergenic
917957920 1:180119179-180119201 CAGGATGACCGCTGTCTGGCAGG + Intergenic
918248207 1:182679291-182679313 CAGTATGGAGGCTGTGTTTCGGG - Intronic
918652669 1:186985071-186985093 TAGAATGAAGGCTGTGTTTGGGG - Intronic
920467527 1:206201920-206201942 GGGAATGAAGGCTGTTTTGCTGG - Exonic
920864682 1:209742028-209742050 CAGGAAGAAGGCAGGTTTGCAGG + Intergenic
921636294 1:217498489-217498511 CATATTTAAGGCTGTGTTGCTGG - Intronic
921945706 1:220884630-220884652 CTGGCTGTGGGCTGTGTTGCAGG - Exonic
923041573 1:230323533-230323555 CAGGATGTAGGCATTGTTGATGG + Exonic
923143874 1:231184568-231184590 CAGGGTGAAGGCAGTGGTACTGG + Intronic
924430825 1:243995040-243995062 AAGGATGAAGGCTGGTTTCCAGG + Intergenic
924532530 1:244905339-244905361 CAGACTGAGGGCTGTGTTTCTGG + Intergenic
1064093790 10:12407603-12407625 TTGGATGAAGACTGTATTGCAGG - Intronic
1064425552 10:15226157-15226179 CAGGAAGAAGCCTGGGTTTCTGG - Intronic
1065413835 10:25462412-25462434 CAGAATGAATGCTGTGTTAGTGG - Intronic
1065493571 10:26306778-26306800 CATGAAGAAGGCTGTGTTACAGG - Intergenic
1067107409 10:43375363-43375385 CAGAATGATGCCTCTGTTGCTGG + Intronic
1067799837 10:49351338-49351360 CAGGCTTCAGGCAGTGTTGCGGG + Intergenic
1069768699 10:70883739-70883761 CAGGATGAAGAGAGTGGTGCAGG + Exonic
1070013754 10:72503439-72503461 GAGGGTGTAGGCTGTGCTGCTGG + Intronic
1070610307 10:77927585-77927607 CAGGAGGAAGGATGTGTCGCCGG + Intergenic
1070667658 10:78356751-78356773 CAGGAGGAAGGCTGGATTGCGGG - Intergenic
1070741587 10:78907059-78907081 CAGGATGGTGGCTGTGTGGAGGG - Intergenic
1070953784 10:80451582-80451604 CATGATGAGGGCAGTGTTCCTGG - Intergenic
1071455808 10:85850606-85850628 CAGGCTGGAGGCTGTGTTTTAGG + Intronic
1075849567 10:125575887-125575909 CATGTTGAAGGCTGTGCTGCAGG - Intergenic
1076131640 10:128017811-128017833 CAGGCTGGAGGCTGTGGTACAGG + Intronic
1077542916 11:3155934-3155956 CAGGCTCAAGCCTGTGTTTCTGG + Intronic
1078740055 11:14058320-14058342 CAGGATGCAGCCTGTGTGACCGG + Intronic
1078993312 11:16670651-16670673 CAGTATGAAGTCTGTGCTGTGGG - Intronic
1080270059 11:30441710-30441732 GAGAATGAAGGCTGTCATGCTGG - Intronic
1080633826 11:34105871-34105893 CAGGATGAAGGCTCTGCATCCGG + Intronic
1080882317 11:36333989-36334011 GAGGATGAAGCCTGTTGTGCAGG - Intronic
1080916067 11:36661398-36661420 CAGACTGAAGGCTGTACTGCCGG - Intergenic
1083795334 11:65013771-65013793 CAGGATTTGGACTGTGTTGCTGG + Intergenic
1084274421 11:68044215-68044237 CAAGATGAAGGCCGTGTACCTGG + Exonic
1087074605 11:94117793-94117815 CATGACTAAGGCTGTGTCGCTGG - Intergenic
1088589995 11:111395161-111395183 CAGGATGGAGGAGCTGTTGCTGG - Intronic
1090509785 11:127363008-127363030 GCGAATGAAGTCTGTGTTGCTGG - Intergenic
1091822638 12:3487701-3487723 CTGGAGGAAAGCTGTGTTGATGG - Intronic
1092060824 12:5548931-5548953 CAGGATGAAGGAGGTGATGGGGG + Intronic
1092254271 12:6917683-6917705 CAGGATGAGGTCTGAGTTCCCGG - Exonic
1092714370 12:11373305-11373327 CAGGAGGAAGGTTGTGGTGAAGG + Intronic
1094372754 12:29755859-29755881 CTGGATCAGGGCTGTGTTGGGGG - Exonic
1094475933 12:30840495-30840517 CAGGATGATGGTAGTGATGCAGG + Intergenic
1100442219 12:94627566-94627588 CAGCAAGGAGGCTGTGTGGCTGG - Intronic
1101593243 12:106140471-106140493 GAGGATGAGGGCAGTGTTTCAGG - Intergenic
1101820957 12:108184031-108184053 AAGGCTGAAGGCTGGGATGCAGG + Intronic
1102487592 12:113268687-113268709 CAGGATGACGGCTGGGCTGCAGG + Intronic
1102991850 12:117321648-117321670 CAGGTTGAAGGCTAAGTTACTGG + Intronic
1103320466 12:120089948-120089970 CAGGAAGAATGCTGTGGAGCTGG + Exonic
1103470625 12:121177524-121177546 CAGGATGAAGCCTGTGATTTGGG - Intronic
1104548102 12:129730876-129730898 CAGACTGAAGGCTGTGCTGTTGG + Intronic
1105899065 13:24741198-24741220 GAGGCTGAGGGCTGTGTGGCTGG - Intergenic
1106186075 13:27411037-27411059 CAGGATAAGGGCTCTGTAGCAGG + Intergenic
1106337964 13:28801448-28801470 CAGGATGAAGGTTATGTTGGGGG + Intergenic
1106820778 13:33462571-33462593 CAGACTGAAGGCTGTGCTGTTGG - Intergenic
1108477645 13:50836728-50836750 AAGGAAGAAGTCTGTGTTGAGGG + Intronic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1113853227 13:113429664-113429686 CAGGAAGAAGGCTGAGGTGGGGG + Intronic
1114332360 14:21650374-21650396 CAGGAGGAAGGCTGAGTTGGAGG - Intergenic
1114863025 14:26550436-26550458 AAGGATGAAGACTGTGTTTAGGG - Intronic
1114867902 14:26620380-26620402 CAGCATGCAGGCTGAGTTCCAGG - Intergenic
1115178603 14:30595149-30595171 CAGGATGAAGCCTGTTTTGTTGG + Intronic
1116307842 14:43281568-43281590 CAGACTGAAGGCTGTGCTGTTGG - Intergenic
1117240007 14:53821467-53821489 CTGGGTGAAGGGTGTGCTGCTGG + Intergenic
1117255463 14:53972739-53972761 CAAGATAAAGCCTATGTTGCTGG + Intergenic
1117803075 14:59464798-59464820 CAGGATGAAGGCGTTGGTGACGG + Exonic
1119484719 14:74980025-74980047 AAGGAGGAAGGCTGTGTGTCTGG - Intergenic
1120037331 14:79712802-79712824 CAGGATGATAGCTGTGAGGCAGG - Intronic
1121111729 14:91317448-91317470 CAGGAGGCAGGCTGTGCTTCAGG - Intronic
1121567185 14:94918935-94918957 CAGGATGCAGCCTGGGTTCCGGG + Intergenic
1122346517 14:101064346-101064368 CAGGAAGGAGGCTCTGATGCAGG + Intergenic
1122856702 14:104563551-104563573 CAGGAGGCAGGCTGTGTTCTGGG - Intronic
1124624375 15:31299718-31299740 CAGGGTGCAGGCTGTGCTGTTGG + Intergenic
1125957238 15:43799005-43799027 CCTGCTGCAGGCTGTGTTGCTGG - Exonic
1126075792 15:44907928-44907950 CAGGATGATAGCTGTATCGCTGG + Intergenic
1126901390 15:53318237-53318259 CAGGCTAAAGGCTGGGGTGCAGG + Intergenic
1127326135 15:57896871-57896893 CAGACTGAAGGCTGTGCTGTCGG - Intergenic
1127416795 15:58765760-58765782 CAGGATGACACCTGTGTAGCAGG + Intergenic
1127966451 15:63926203-63926225 GAGGGGGCAGGCTGTGTTGCTGG - Intronic
1128798806 15:70483863-70483885 CAGAATGCAGGCTTTGTTACTGG + Intergenic
1128903204 15:71444143-71444165 CATGATGAATGGTGGGTTGCTGG + Intronic
1129351920 15:74960506-74960528 CAGGAAGTAGGGTGTGCTGCTGG - Intronic
1129703768 15:77782983-77783005 CAGGAGGAAGACAGTGTGGCTGG - Intronic
1130054204 15:80508250-80508272 CAGGATGAGGTCTGTTTTGGGGG + Exonic
1132113547 15:99119474-99119496 CAAGATGAAGGATGGGTTGATGG + Intronic
1132796120 16:1723957-1723979 TAGGAGCAAGACTGTGTTGCTGG + Intronic
1134070202 16:11255898-11255920 CCGGAGAAAGGCTGTGCTGCGGG + Intronic
1134275850 16:12775394-12775416 GAGGATGATGGCAGTGCTGCAGG - Intronic
1134726755 16:16424587-16424609 CAGAATGAAGGCTGCACTGCTGG - Intergenic
1134940679 16:18287276-18287298 CAGAATGAAGGCTGCACTGCTGG + Intergenic
1135876047 16:26200927-26200949 CAGGGTGAAGGCTCTTTTTCTGG + Intergenic
1136005457 16:27325983-27326005 CAGGATGGATGCTGTGGGGCGGG - Intronic
1137816385 16:51401800-51401822 CAGACTGAAGGCTGCATTGCTGG - Intergenic
1138346444 16:56323136-56323158 CAGGAGTAAGGCTGTATGGCTGG + Intronic
1138347350 16:56328243-56328265 CAGGATGAAAGCAGAGCTGCTGG + Intronic
1138550604 16:57745945-57745967 CAGGATGACAGCTGGGCTGCAGG - Intronic
1138624313 16:58237002-58237024 CGGGATGAAGGCTGGGAGGCAGG + Intronic
1138676144 16:58652953-58652975 CAGGGTGAACGCTAGGTTGCAGG + Intergenic
1141659346 16:85433546-85433568 CCAGATGAAGGCTGTGTAGATGG + Intergenic
1142640707 17:1284280-1284302 CAGTATGAGGCCTGTGTTCCTGG + Intronic
1143247523 17:5499323-5499345 CAGGATTAAGTCTGTTTTGGAGG + Intergenic
1143269635 17:5666105-5666127 CAAGATGAAGCCTGAGTTCCAGG + Intergenic
1143510111 17:7390651-7390673 GAGGGTGAAGGCTGTGCTGCTGG - Exonic
1145240817 17:21240309-21240331 CACGCTGAAGGCTGTGCTGAGGG + Exonic
1147157886 17:38553576-38553598 CAGGAAAGAGGCTGTGTGGCTGG - Intronic
1148191425 17:45681319-45681341 CAGGATGAGGGTGGAGTTGCAGG - Intergenic
1148656745 17:49289822-49289844 AAGGATGAAGGCCATGTGGCTGG - Intronic
1150295172 17:64003526-64003548 CAGGATGAAGGGTGGGCTCCTGG + Intronic
1152290115 17:79435595-79435617 CAGGAGCCAGGCTCTGTTGCAGG - Intronic
1152402320 17:80074706-80074728 CAGAATAAATGCTGTGTTACAGG - Intronic
1152521464 17:80859078-80859100 CGGGCTGAAGCCTGTGTGGCCGG + Intronic
1155451165 18:25964087-25964109 CGGGATGAGGGCTGTGTAGGAGG - Intergenic
1156471080 18:37377661-37377683 CAGGAAGACGGGTGTGTTCCTGG + Intronic
1158496506 18:57959908-57959930 CAGGTGGAAGGCTGTTTTTCAGG + Intergenic
1160477424 18:79204962-79204984 GAGAATGAAGGCTATGATGCTGG - Intronic
1160542456 18:79631981-79632003 CAGGATGTAGACTGTGAGGCTGG + Intergenic
1160932668 19:1578032-1578054 CAGGAGGAAGGCCGTGCTCCTGG - Exonic
1161577878 19:5064858-5064880 CTGGATGAGGGGTGTGATGCTGG - Intronic
1162111124 19:8400330-8400352 GAGGAGGAAGGCTGGGATGCTGG - Intronic
1162862724 19:13519349-13519371 CAGGATGAAAGCTGTATGCCAGG - Intronic
1162933204 19:13967247-13967269 CAGGATCAAGGATGTGTGGCTGG + Intronic
1164607868 19:29613013-29613035 CAGGAGGAAGGCAGTGTGGGAGG - Intronic
1166198593 19:41221922-41221944 CAGGTTGAAGGGGGTGTTGGCGG - Exonic
1167396808 19:49234923-49234945 CAGGAGGGAGGCTGGGTTGATGG + Intergenic
925477353 2:4232141-4232163 CAGGAAAAGGGGTGTGTTGCAGG + Intergenic
925746125 2:7045253-7045275 CATGATAAAGGCTGTGTGGGAGG + Intronic
926649826 2:15330746-15330768 CAGGATGAAGTAGGTGTTCCAGG - Exonic
927132837 2:20074982-20075004 CAGGATGGAGGCAGGGTGGCTGG - Intergenic
928299519 2:30112971-30112993 CAGATTGAAGGCTGTGCTGTCGG + Intergenic
928490183 2:31775264-31775286 CAGAATGAAGACTGTACTGCTGG + Intergenic
929870704 2:45756805-45756827 CAGGATGGAGGTTGTGTGGGAGG + Intronic
931697416 2:64881818-64881840 CAGCATGCAGGCTGTGGCGCTGG + Intergenic
932054788 2:68433050-68433072 CAGGAGGGAGGCTGAGTTGGGGG - Intergenic
932732510 2:74231272-74231294 CAGGATGAAGACGATGATGCCGG + Exonic
936010082 2:108919953-108919975 GAGGATGAAGGCTGTGTGTGTGG - Intronic
936376722 2:111947436-111947458 GAGGTTGAAGGCTGTGTTTCTGG - Exonic
939464435 2:142539079-142539101 CAGGATGATGGTGGTGTTACCGG - Intergenic
941036358 2:160573101-160573123 CAGGCTGAAGGCTGCACTGCTGG + Intergenic
941639280 2:167969977-167969999 CAGCATGGAGGCTGTGTGGCTGG - Intronic
942264331 2:174205883-174205905 TGGGCTGTAGGCTGTGTTGCAGG - Intronic
944460476 2:199944331-199944353 CAGGATGAGAGCAGTGTTACTGG - Intronic
947857514 2:233334050-233334072 CAGGATGGAGGGTGTGCTTCCGG + Intronic
1169716113 20:8620441-8620463 CAGAATGCAGGCTGTCTGGCTGG + Intronic
1170579600 20:17687839-17687861 CAGAAAGAAGGTTGTGTGGCTGG + Intergenic
1170840752 20:19922976-19922998 CAGGATGAAGGCTGCGTCCAAGG - Intronic
1174624062 20:51899798-51899820 CATGAGGAAGGCAGTGTTGATGG + Intergenic
1175508358 20:59503689-59503711 CAGGATCAAGGTTGGGGTGCAGG - Intergenic
1175590232 20:60183869-60183891 GAGGATCAATGCTGTGGTGCTGG - Intergenic
1177489653 21:21805708-21805730 CAGACTGAAGGCTGCATTGCTGG + Intergenic
1178789492 21:35686949-35686971 CAGGATGAAGGGTGAGATTCTGG - Intronic
1179770486 21:43611772-43611794 CGGGATGAGGGCAGAGTTGCAGG + Intronic
1180217767 21:46336857-46336879 CAGAATGAACTCTGTGGTGCTGG - Intronic
1181743441 22:24939473-24939495 GAGGCTGAAGGCTGAGGTGCAGG + Intronic
1181868863 22:25881971-25881993 GAGGATGAAGGGAGTGTTTCAGG - Intronic
1182062914 22:27410685-27410707 CAGGATGCAGGCTGTGTGTTCGG - Intergenic
1182511883 22:30825824-30825846 CAGTATGAAGGCTGGCTTGTGGG - Intronic
1182781172 22:32869098-32869120 CAGGATGAAGTCTGGCTTGAAGG + Exonic
1183492924 22:38126397-38126419 CAGGATGAACGCTGGCTTCCGGG + Exonic
1184532279 22:45063859-45063881 CAGGAGGAAGACTAGGTTGCAGG + Intergenic
1184725161 22:46340301-46340323 CAAGATCAAGGCTGGGTGGCTGG + Intronic
1184841921 22:47057098-47057120 CAGGCTGAATGCAGTGTTGTTGG + Intronic
1185257849 22:49846165-49846187 CAGGTTGTAGGCTGTGTTTCTGG - Intergenic
951076606 3:18401110-18401132 CAGGATGAGTGCTCTGCTGCAGG - Intronic
954275526 3:49539545-49539567 CAGCATGAAGACCGGGTTGCTGG + Intergenic
957949143 3:87102018-87102040 CAGGATGTGGGCTGTGTGGGAGG + Intergenic
958987492 3:100799273-100799295 TATGATGAAGGCACTGTTGCAGG - Intronic
961680036 3:128593697-128593719 CAGGAGGGAGGCTGTGGTGTGGG + Intergenic
964590937 3:158361249-158361271 CAGCAGGACGGCTGTGTTGCTGG + Intronic
967223026 3:187265236-187265258 CAGAAAGAAGCCTGTGTAGCTGG - Intronic
968105776 3:196000221-196000243 CAGGTTGAGGGCTGTGGAGCTGG - Intergenic
968303984 3:197637447-197637469 CAGGTTGAGGGCTGTGGAGCTGG - Intergenic
968735996 4:2296861-2296883 CAGGTAGAAGGCTGAGCTGCTGG - Intronic
968748164 4:2371887-2371909 CAGGATGAAGGTTGGGCTCCAGG + Intronic
968871551 4:3245241-3245263 GAAGAGGAAGGCTGTGTTGAGGG - Intronic
969284319 4:6193236-6193258 CAGGCTGAAGGCTGTGCTGTTGG + Intronic
969643269 4:8411908-8411930 CAGGATCCAGGCTGGGCTGCTGG - Intronic
970082049 4:12298755-12298777 CAGACTGAAGGCTGTGCTGTCGG - Intergenic
972374917 4:38460929-38460951 CAGGATGAAAGATGTGTTAAAGG - Intergenic
972559992 4:40218486-40218508 CAGGCTGAGGGCTTTTTTGCAGG + Intronic
972874255 4:43338986-43339008 CTGGATGAAGGCTGTCCTGGAGG + Intergenic
975499403 4:75068503-75068525 AAGGAAGAAGGATGTGTTGTGGG + Intergenic
975618750 4:76274699-76274721 GAGGAAGAAGGCAGTGTTCCTGG + Intronic
975796248 4:78009535-78009557 CAGGATGACAGCTGTGTATCAGG - Intergenic
976364123 4:84214066-84214088 TAGGAGGGAGGCTGTGCTGCAGG + Intergenic
976759500 4:88533060-88533082 CAGGCTGAAGGCTGCGCTGTCGG - Intronic
976801355 4:88995619-88995641 CAGACTGAAGGCTGTGCTGTGGG + Intronic
976801898 4:89002298-89002320 CTGGATGCAGGCGGTGTTGAAGG - Intronic
977024732 4:91803153-91803175 CAGAATGAATGTTGTGTTGGAGG - Intergenic
979138889 4:117147509-117147531 CAGAATGAAGGCTGCATTGTTGG + Intergenic
979203681 4:118009086-118009108 CAGGAAGGGGACTGTGTTGCAGG - Intergenic
979300578 4:119081919-119081941 CATGATCAAGCCTGTGTTGTAGG + Intergenic
980937828 4:139242969-139242991 CAGGATTACAGCTGTGTTTCTGG - Intergenic
981416185 4:144496503-144496525 GAGAATGAAGGCTATGTTCCTGG - Intergenic
981681856 4:147408417-147408439 CAGGGTGCAGGCTGTGTTCTTGG + Intergenic
982271699 4:153596485-153596507 CAGGATGAAGGCTGTGTTGCGGG + Intronic
983213889 4:164984755-164984777 CAGAATGAAACCTGTCTTGCTGG + Intergenic
984066426 4:175053799-175053821 CAGGATGTAGGCTGAGTCCCAGG + Intergenic
985379396 4:189376364-189376386 TAGTTTGAAGGCTGTATTGCTGG - Intergenic
987521763 5:18994632-18994654 CAGAATGAAGGCTGTACTGTTGG - Intergenic
988657281 5:33226195-33226217 CAGAATGAAACCTATGTTGCTGG + Intergenic
989562817 5:42871012-42871034 CAGGGTGAGGCCTGTGATGCTGG - Intronic
990194765 5:53302065-53302087 CAGGGTGAAGGGCATGTTGCTGG - Intergenic
1000355326 5:160388899-160388921 CAGACTGAAGGCTGTATTGTTGG + Intergenic
1001902303 5:175442671-175442693 CAGGATGAAGGCTGCCTTGGGGG + Exonic
1001945103 5:175772184-175772206 CAGGATGAGGGCTGGTTTCCAGG - Intergenic
1002695780 5:181087400-181087422 CAGGATGAGGTCTGTGCTGTTGG + Intergenic
1003343605 6:5244914-5244936 CAGGCTGAGGGCTGTTTTCCTGG + Intronic
1004703722 6:18103322-18103344 CAAGATGACAGCTGTGTTTCAGG - Intergenic
1005198735 6:23319090-23319112 CTGGGTGAAGGCTATGTTGGAGG + Intergenic
1005441718 6:25876475-25876497 CAGGATGCAGGCTCTGATTCTGG + Intronic
1006799855 6:36752910-36752932 CTGGTTGAAGGCTGTGGTGCTGG - Intronic
1006932362 6:37696001-37696023 CAGGAGCAAGGCTGCGTGGCAGG + Intronic
1008011076 6:46468499-46468521 CAGGATGGGGGCTGCTTTGCTGG - Intronic
1008095421 6:47334924-47334946 CAGGATGGAGGCTGTTTGCCAGG + Intergenic
1008168121 6:48166316-48166338 CAGAATGAAGGCTGCGCTGCGGG - Intergenic
1008296908 6:49789486-49789508 CAGAATGAACTCTGTGGTGCTGG + Intergenic
1010766234 6:79779437-79779459 CAGCATAAAGGCTATGTAGCAGG + Intergenic
1013287985 6:108697258-108697280 GAGCATGGAGGCTGTGTAGCTGG - Intergenic
1014599829 6:123397299-123397321 CAGGATAAAGTCTGTGTGGTAGG - Intronic
1014632419 6:123803485-123803507 CAGGATGAAGGATTTGTTGTAGG + Intergenic
1015155451 6:130089988-130090010 CAGGATGAAAGCTTTGTACCAGG - Intronic
1016362855 6:143286789-143286811 CAGGCTGCTGGCTGTTTTGCTGG + Intronic
1016480422 6:144475392-144475414 AAGAATGAAGGCAGTGTAGCTGG + Intronic
1016488664 6:144571917-144571939 CAGCATGATGGCTGTGCAGCAGG - Intronic
1016613474 6:146020630-146020652 AAGGATAAAGGATGTGTTTCAGG + Intergenic
1017072139 6:150584950-150584972 TTGGAAGAAGGCTGTGGTGCTGG - Intergenic
1017777292 6:157690102-157690124 CAGGAGCAAGTCGGTGTTGCGGG - Intergenic
1018282493 6:162202046-162202068 CAGGAAGAAGGTTGTATTTCTGG - Intronic
1018895353 6:168012926-168012948 CAGGTTTCAGGCTGTGTGGCTGG + Intronic
1020571399 7:9867960-9867982 AAGAATGAATTCTGTGTTGCTGG + Intergenic
1021236260 7:18146016-18146038 CAGCATGAAGACTCTTTTGCTGG - Intronic
1021948382 7:25750903-25750925 CAGGATCAATGCCGTGTGGCTGG + Intergenic
1024083219 7:45872989-45873011 CAGGATGGAGCCTGGGGTGCAGG - Intergenic
1024779630 7:52832678-52832700 GGGGAAGAAGGCAGTGTTGCAGG - Intergenic
1025791092 7:64687390-64687412 GAGAATGAAGCCTGAGTTGCAGG - Intronic
1026382630 7:69814641-69814663 CAGGCTGAAAGCAGGGTTGCAGG - Intronic
1026533384 7:71219912-71219934 CAGGTGGATGGCTGTTTTGCTGG + Intronic
1026948820 7:74333789-74333811 GAGGTTTAAGTCTGTGTTGCTGG + Intronic
1029834745 7:103297418-103297440 GAGGATGAAGGATGTGCTTCCGG - Exonic
1031588410 7:123560607-123560629 CAGAATGAAATCTGTCTTGCTGG - Intergenic
1032186077 7:129727805-129727827 CAGGCAGCAGGCTGTGATGCCGG + Intronic
1033080482 7:138292137-138292159 CAGAATGAATATTGTGTTGCAGG + Intergenic
1034262025 7:149763245-149763267 CAGGAAGGAGGCTGTGTGGGTGG - Intergenic
1034350753 7:150413372-150413394 CAGGCAGAAGGCTGAGCTGCCGG - Intergenic
1036203435 8:6787920-6787942 CAGGATGCATGCTGAGCTGCTGG + Intergenic
1037603240 8:20416506-20416528 CAGTATGAAGGCTGTGTTTCTGG + Intergenic
1037784538 8:21894826-21894848 CAGGATGTAGGCTGCTTTGAGGG + Intergenic
1039071547 8:33653286-33653308 CAGGAAGAAGGCTGGGTGGTGGG + Intergenic
1039431219 8:37526567-37526589 CAGGATGAAGGCTCTGCAGCAGG + Intergenic
1039979811 8:42399465-42399487 CATGATGAAGGCTGGGGTGAGGG + Intronic
1042419648 8:68570698-68570720 CCAGATGATGGCTGTGCTGCTGG - Intronic
1042555232 8:70028780-70028802 CAGGATGATGGCTATGTCCCAGG - Intergenic
1042817554 8:72894268-72894290 CAGCAGGAGGGCTGTGTAGCTGG + Intronic
1042840981 8:73123598-73123620 CAGACTGAAGGCTGTGCTGTCGG - Intronic
1044492096 8:92831187-92831209 CCTGATGAAGGCTGTGTTCAGGG + Intergenic
1045145701 8:99341552-99341574 CAGGAAGAAGGAAGTGCTGCAGG - Intronic
1045892628 8:107175167-107175189 CAGGGTGAAGGCTGTACTCCAGG + Intergenic
1046357539 8:113107719-113107741 CTGGATGGAGGCTGTGTTCTTGG + Intronic
1046772461 8:118129680-118129702 CAGGGAGATGGCTGTGATGCAGG - Intergenic
1046782744 8:118232822-118232844 CAGGATGAAGGCTGTGGCGCCGG + Intronic
1047518824 8:125578666-125578688 CAGGAGGTAGGCCGGGTTGCTGG + Intergenic
1047818970 8:128497188-128497210 CTGTCTGAAGGCTGTTTTGCAGG + Intergenic
1048337241 8:133512195-133512217 CAGACTGAAGGCTGTGCTGTTGG - Intronic
1048746928 8:137624854-137624876 CAGACTGAAGGCTGCGTTGTCGG - Intergenic
1049797270 8:144502572-144502594 CAGGATTAAGGCTGCGTGCCAGG - Intergenic
1050152985 9:2635530-2635552 GGGGATGAAGACTGTGTTGACGG + Exonic
1053072277 9:35108300-35108322 CAGCATAAAGGCCGTGTTGGGGG - Exonic
1056966429 9:91166350-91166372 CAGGGTGGAGTCTCTGTTGCTGG - Intergenic
1058363576 9:104179994-104180016 CAGGATCAGGGCTGAGATGCTGG + Intergenic
1059564592 9:115371066-115371088 CAGGATGAAGGTAGTGTAGAGGG + Intronic
1060587414 9:124795204-124795226 CAGGGTGAAGCCTGGATTGCCGG - Intronic
1061057527 9:128232437-128232459 CGGGATGATGGGTGTGATGCGGG + Intronic
1061262391 9:129487509-129487531 CAGAATGTGGGCTGTGTTTCTGG + Intergenic
1061385449 9:130286854-130286876 CAGGAGCAAGGCTGAGTGGCAGG - Intronic
1061822941 9:133238633-133238655 CAGGGTCAAGGCTGTGTTGAGGG + Intergenic
1062408732 9:136410665-136410687 CAAGATGGCGGCTGTGGTGCTGG + Exonic
1186883167 X:13886804-13886826 AAAGATGAAGGCTGTGTTAGAGG - Intronic
1187673333 X:21690535-21690557 GAGGATGCAGATTGTGTTGCAGG - Intergenic
1188743326 X:33811565-33811587 CAGGATGCAGTCTGGGGTGCTGG + Intergenic
1188771712 X:34161486-34161508 CAGAATGAAGGCTGTATTGTTGG + Intergenic
1192184052 X:68934595-68934617 AAGGAGGAAGGAGGTGTTGCTGG - Intergenic
1195004339 X:100671406-100671428 CAGGATGAGGGGTGGGTAGCAGG + Intergenic
1195907064 X:109854528-109854550 CAGGAAGAAAGCTGTGCTGTAGG + Intergenic
1196311904 X:114178120-114178142 CAGGAAAAAGGCTCTTTTGCTGG + Intergenic
1198023292 X:132680307-132680329 AAAAAAGAAGGCTGTGTTGCGGG - Intronic
1199861109 X:151801217-151801239 AAGGCTGAAGGCTGGGCTGCTGG - Intergenic
1200684447 Y:6246388-6246410 CAGGATGGAGGCTGTGCAGGAGG + Exonic
1200995292 Y:9378241-9378263 CAGGATGGAGGCTGTGCAGGAGG + Intronic
1201000465 Y:9467120-9467142 CAGGATGGAGGCTGTGCAGGAGG + Exonic
1201437877 Y:13979023-13979045 CAGACTGAAGGCTGTGCTGTGGG - Intergenic