ID: 982272432

View in Genome Browser
Species Human (GRCh38)
Location 4:153604949-153604971
Sequence CAGCACTTCTGGAGGCCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6049
Summary {0: 1, 1: 6, 2: 172, 3: 1842, 4: 4028}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982272432_982272439 6 Left 982272432 4:153604949-153604971 CCCTTTGGCCTCCAGAAGTGCTG 0: 1
1: 6
2: 172
3: 1842
4: 4028
Right 982272439 4:153604978-153605000 TAGGCGTGAGCCACCGAACCTGG 0: 3
1: 694
2: 13975
3: 80306
4: 151771

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982272432 Original CRISPR CAGCACTTCTGGAGGCCAAA GGG (reversed) Intronic
Too many off-targets to display for this crispr