ID: 982272439

View in Genome Browser
Species Human (GRCh38)
Location 4:153604978-153605000
Sequence TAGGCGTGAGCCACCGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246749
Summary {0: 3, 1: 694, 2: 13975, 3: 80306, 4: 151771}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982272432_982272439 6 Left 982272432 4:153604949-153604971 CCCTTTGGCCTCCAGAAGTGCTG 0: 1
1: 6
2: 172
3: 1842
4: 4028
Right 982272439 4:153604978-153605000 TAGGCGTGAGCCACCGAACCTGG 0: 3
1: 694
2: 13975
3: 80306
4: 151771
982272427_982272439 25 Left 982272427 4:153604930-153604952 CCGACCTCAAGTGATCCACCCCT 0: 1
1: 34
2: 754
3: 5788
4: 12554
Right 982272439 4:153604978-153605000 TAGGCGTGAGCCACCGAACCTGG 0: 3
1: 694
2: 13975
3: 80306
4: 151771
982272436_982272439 -2 Left 982272436 4:153604957-153604979 CCTCCAGAAGTGCTGGGATTATA 0: 22
1: 1276
2: 38987
3: 343708
4: 277940
Right 982272439 4:153604978-153605000 TAGGCGTGAGCCACCGAACCTGG 0: 3
1: 694
2: 13975
3: 80306
4: 151771
982272428_982272439 21 Left 982272428 4:153604934-153604956 CCTCAAGTGATCCACCCCTTTGG 0: 1
1: 28
2: 245
3: 2472
4: 18473
Right 982272439 4:153604978-153605000 TAGGCGTGAGCCACCGAACCTGG 0: 3
1: 694
2: 13975
3: 80306
4: 151771
982272438_982272439 -5 Left 982272438 4:153604960-153604982 CCAGAAGTGCTGGGATTATAGGC 0: 541
1: 26095
2: 254812
3: 283697
4: 270502
Right 982272439 4:153604978-153605000 TAGGCGTGAGCCACCGAACCTGG 0: 3
1: 694
2: 13975
3: 80306
4: 151771
982272430_982272439 10 Left 982272430 4:153604945-153604967 CCACCCCTTTGGCCTCCAGAAGT 0: 1
1: 1
2: 13
3: 303
4: 2022
Right 982272439 4:153604978-153605000 TAGGCGTGAGCCACCGAACCTGG 0: 3
1: 694
2: 13975
3: 80306
4: 151771
982272433_982272439 5 Left 982272433 4:153604950-153604972 CCTTTGGCCTCCAGAAGTGCTGG 0: 1
1: 59
2: 1487
3: 3405
4: 4798
Right 982272439 4:153604978-153605000 TAGGCGTGAGCCACCGAACCTGG 0: 3
1: 694
2: 13975
3: 80306
4: 151771
982272431_982272439 7 Left 982272431 4:153604948-153604970 CCCCTTTGGCCTCCAGAAGTGCT 0: 4
1: 185
2: 5469
3: 70503
4: 159635
Right 982272439 4:153604978-153605000 TAGGCGTGAGCCACCGAACCTGG 0: 3
1: 694
2: 13975
3: 80306
4: 151771

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982272439 Original CRISPR TAGGCGTGAGCCACCGAACC TGG Intronic
Too many off-targets to display for this crispr