ID: 982274247

View in Genome Browser
Species Human (GRCh38)
Location 4:153623097-153623119
Sequence AGAGCCCCAGGCACTCTCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 141}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982274239_982274247 11 Left 982274239 4:153623063-153623085 CCCAGCACTTCCTGCCGGCCGGT 0: 1
1: 0
2: 2
3: 8
4: 118
Right 982274247 4:153623097-153623119 AGAGCCCCAGGCACTCTCGGTGG 0: 1
1: 0
2: 2
3: 15
4: 141
982274241_982274247 1 Left 982274241 4:153623073-153623095 CCTGCCGGCCGGTGAGTCCTGAG 0: 1
1: 0
2: 0
3: 3
4: 84
Right 982274247 4:153623097-153623119 AGAGCCCCAGGCACTCTCGGTGG 0: 1
1: 0
2: 2
3: 15
4: 141
982274240_982274247 10 Left 982274240 4:153623064-153623086 CCAGCACTTCCTGCCGGCCGGTG 0: 1
1: 1
2: 0
3: 13
4: 159
Right 982274247 4:153623097-153623119 AGAGCCCCAGGCACTCTCGGTGG 0: 1
1: 0
2: 2
3: 15
4: 141
982274235_982274247 24 Left 982274235 4:153623050-153623072 CCCATGGTGGACGCCCAGCACTT 0: 1
1: 0
2: 0
3: 7
4: 74
Right 982274247 4:153623097-153623119 AGAGCCCCAGGCACTCTCGGTGG 0: 1
1: 0
2: 2
3: 15
4: 141
982274236_982274247 23 Left 982274236 4:153623051-153623073 CCATGGTGGACGCCCAGCACTTC 0: 1
1: 0
2: 0
3: 5
4: 91
Right 982274247 4:153623097-153623119 AGAGCCCCAGGCACTCTCGGTGG 0: 1
1: 0
2: 2
3: 15
4: 141
982274242_982274247 -3 Left 982274242 4:153623077-153623099 CCGGCCGGTGAGTCCTGAGCAGA 0: 1
1: 0
2: 0
3: 9
4: 109
Right 982274247 4:153623097-153623119 AGAGCCCCAGGCACTCTCGGTGG 0: 1
1: 0
2: 2
3: 15
4: 141
982274243_982274247 -7 Left 982274243 4:153623081-153623103 CCGGTGAGTCCTGAGCAGAGCCC 0: 1
1: 0
2: 2
3: 41
4: 230
Right 982274247 4:153623097-153623119 AGAGCCCCAGGCACTCTCGGTGG 0: 1
1: 0
2: 2
3: 15
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982274247 Original CRISPR AGAGCCCCAGGCACTCTCGG TGG Intronic
900616775 1:3569068-3569090 ATAGCCCCAGACACTCCCAGAGG + Intronic
900781836 1:4623667-4623689 AGACCACCAGGCACTCTGGCAGG - Intergenic
900938897 1:5784970-5784992 AGAGCCCCAGCCACTTTCAGGGG + Intergenic
900945995 1:5831771-5831793 AGAGCCCCAGGCCCTTGCAGAGG + Intergenic
901268810 1:7934355-7934377 ACAGAACAAGGCACTCTCGGGGG + Intronic
902196687 1:14803555-14803577 AGAGCCACGGGCACTCAGGGCGG - Intronic
905308400 1:37034118-37034140 CGCGCCCCGGGCACGCTCGGCGG - Exonic
905441946 1:38001338-38001360 AGAGGCCCAGGCACCCCCTGTGG - Intronic
907737055 1:57124397-57124419 AGAGTCTCAGACACTCTCGTTGG + Intronic
910756825 1:90702866-90702888 AGAGCCCCAGCTACTCGGGGGGG + Intergenic
919732336 1:200921359-200921381 AGAGACCCAGGCGCTCTGAGGGG - Intergenic
922620700 1:226986368-226986390 AGCGCCCCGGGCACTGTGGGAGG + Intronic
924932054 1:248740572-248740594 AGAGGCCAAGGGACTCACGGAGG + Intronic
1066133479 10:32418085-32418107 AGAGTTCCAGGAACTCTGGGAGG - Intergenic
1066551628 10:36564918-36564940 AGAGCGCCAGCCTCTCTCAGAGG - Intergenic
1067759191 10:49030379-49030401 TGGGGCCTAGGCACTCTCGGAGG + Intronic
1069531489 10:69222773-69222795 AGTGCCCCAGGAAGTCTCTGGGG + Intronic
1069908713 10:71747163-71747185 TGAGCCCCAGGGTCTCTTGGAGG - Intronic
1070627477 10:78061604-78061626 AGAGCCCCAGCTTCTCTCAGAGG - Intergenic
1072905043 10:99445289-99445311 AGAGTCCCAGGCCCTCTGCGTGG - Intergenic
1074395622 10:113095739-113095761 GGAAGCCCAGGCACTCTCTGTGG + Intronic
1075517968 10:123124566-123124588 AGAGCCCTATGCACTGTTGGTGG - Intergenic
1075941541 10:126394527-126394549 AGAGCCCCAGGTACTTTGGCAGG - Intergenic
1076571447 10:131435928-131435950 GGAGCCCCTGGCACTCTGGCCGG + Intergenic
1077521272 11:3036553-3036575 AGAACCCCATGCACTATGGGTGG + Intronic
1077552143 11:3205261-3205283 AGGGACGTAGGCACTCTCGGTGG - Intergenic
1079987661 11:27215746-27215768 AGAGCCTCCAGCACTCTCAGTGG - Intergenic
1080382372 11:31787108-31787130 AGAGCTCCAGGCACTCTCTTGGG - Exonic
1081198250 11:40187055-40187077 TGAGCCCCAGGCAGTCGCCGCGG - Intronic
1081541050 11:44034828-44034850 AGAGTCCCAGGCACCCTGAGTGG + Intergenic
1083227558 11:61294566-61294588 AGAGCCACGGGCACGCTGGGGGG + Intronic
1083276515 11:61599978-61600000 AGACCCCCAGGCCCTGTGGGTGG - Intergenic
1083285987 11:61659395-61659417 AGTGCCCCAAGCACTGTCGCTGG - Intergenic
1083936900 11:65873854-65873876 TGAGCCCCAGGCGCTCGCCGCGG - Intergenic
1084311243 11:68317465-68317487 AGGGCTCCAGGCCCCCTCGGGGG - Intronic
1084471294 11:69360710-69360732 ACAGCCCCAGGCACTATGGGAGG - Intronic
1089306491 11:117529692-117529714 CAAGCCCCAGGAGCTCTCGGGGG + Intronic
1095366212 12:41409312-41409334 AGATCCCCAGGCACTCTGGTAGG + Intronic
1095983058 12:47983602-47983624 ACAGCAGCAGGCACTATCGGTGG - Intronic
1096543583 12:52322136-52322158 AGAGCTCCAGGGACTCATGGAGG + Intergenic
1100790334 12:98123366-98123388 AGTGCTCCAGGCAATCTCGCAGG + Intergenic
1102581879 12:113894430-113894452 AGAACCCCTGGCACCCTCTGAGG + Intronic
1103516130 12:121509575-121509597 GGACCCCCAGGCACTCCTGGAGG - Exonic
1103841416 12:123868312-123868334 AGAAGCCCAGGCCCTCTGGGTGG + Intronic
1103955615 12:124574972-124574994 GGAATCCCAGGCACTTTCGGAGG - Intergenic
1104454642 12:128901009-128901031 AGAGTCCCAGGGAATCTCAGAGG - Intronic
1106656878 13:31755983-31756005 AGAGCCTCTGGCCCTCTCTGGGG - Intronic
1110814850 13:79849898-79849920 AGAGCCCCAGGGACTCAGGGAGG - Intergenic
1111497522 13:89071436-89071458 AGAGCCCCAGGGAATCAGGGAGG + Intergenic
1118336269 14:64855887-64855909 ACAGCACCAGGCACTCTGGTAGG + Intronic
1119474994 14:74922064-74922086 AGAGCCCCAGGCCTGCGCGGTGG - Exonic
1121336616 14:93081736-93081758 AGAGCCCCAGACACCCTTTGGGG - Intronic
1126761180 15:51971547-51971569 AGCGCCCCCTGCACTCCCGGAGG - Intronic
1127055247 15:55124936-55124958 AGAACACCAGGCACTTTTGGCGG + Intergenic
1127103103 15:55587746-55587768 AGAGCCCCATGGCCTCCCGGCGG + Intronic
1128245230 15:66128267-66128289 AGATGGCCAGGCACTCTCTGGGG - Intronic
1130543548 15:84839188-84839210 AGATGCCCAGGCACTCTCTGGGG + Intronic
1132688399 16:1171722-1171744 AGAGCTCCAGGGACTCCAGGAGG - Intronic
1133175753 16:4012993-4013015 TGTGACCCCGGCACTCTCGGAGG + Intronic
1135271584 16:21074314-21074336 AGATGCCCAGGCATTCTGGGAGG + Intronic
1137615861 16:49846616-49846638 AGAGACCCCAGCACTCTCTGTGG + Intronic
1138457982 16:57132244-57132266 AGACCCTCAGCCACTCTCTGGGG - Intronic
1142272563 16:89097982-89098004 AGAGCCCCAGGCTACCTGGGAGG + Intronic
1143400462 17:6639508-6639530 AAAGCCCCAGGCACACTCGCAGG + Intronic
1146943208 17:36858162-36858184 ACAGCCCCAGGCTCTGTCTGGGG - Intergenic
1147726525 17:42569023-42569045 ACAGTCCCAGGCACCCTAGGGGG + Intronic
1147755149 17:42762609-42762631 AGTGCTCCAGGCAATCTCGCAGG - Exonic
1150444852 17:65221019-65221041 AGAGCCCCAGGCTCCATGGGAGG + Intronic
1152737298 17:82003839-82003861 AGCGCCCCGGCCACCCTCGGAGG - Intronic
1153275979 18:3368284-3368306 TGTGCCCCTGGCACTCTGGGTGG + Intergenic
1154095680 18:11413163-11413185 AGAGCCCGAGGCCCTCTCACAGG + Intergenic
1155467504 18:26154531-26154553 AGAGCCCCAGGCCTTCTCGGTGG - Intronic
1158481276 18:57823890-57823912 AGAGCACCAGGCAGCCTCTGGGG - Intergenic
1164540915 19:29120935-29120957 AGAGCTGCAGGCAGACTCGGGGG + Intergenic
1165106863 19:33475417-33475439 TGGGTCCCAGTCACTCTCGGTGG - Intronic
1166046863 19:40235027-40235049 GGGGCCCCAGGCACTCACAGCGG + Exonic
924965546 2:73326-73348 AGAGCCACAGGAACTTTCTGGGG - Intergenic
925262710 2:2542402-2542424 GCAGCCCCAAGCACTCTCTGGGG + Intergenic
928197381 2:29225428-29225450 AGAGCCCCAGGGACTCCCAAGGG - Intronic
928442591 2:31304415-31304437 TGAGCCCCAGCCCCTCTCCGGGG - Intergenic
929121494 2:38487679-38487701 GGAGAGCCCGGCACTCTCGGAGG + Intergenic
929887781 2:45893895-45893917 AGAGCCCCAGCCTCTCCAGGAGG - Intronic
932827956 2:74958767-74958789 CGAGCCCCAGGCACACTCGTTGG - Exonic
935062086 2:99617267-99617289 AGAACCCCATGCACTCCTGGTGG - Intronic
943504671 2:188739699-188739721 AGAGGCTCAGGGACTCTAGGTGG + Intronic
948046899 2:234952017-234952039 AGCGCGCCCGGCACTCTCGGCGG + Intronic
949011156 2:241679329-241679351 AGAGCCGCAGGCTCTGTGGGAGG - Intronic
949072347 2:242033246-242033268 TGAGCACCAGGCACTGTCAGGGG + Intergenic
1170750630 20:19141643-19141665 AGAGCTCAAGGCAACCTCGGTGG - Intergenic
1173581886 20:44152789-44152811 AGAGCCGTAGGCACCCACGGAGG - Intronic
1175443967 20:59007707-59007729 AAAGGCCCAGGCCCTTTCGGGGG + Intergenic
1175673905 20:60930940-60930962 AGAGGGCCAGGGACTCTCAGGGG - Intergenic
1175981638 20:62741594-62741616 AGAGCCCCAGGGAGCCTCAGGGG - Intronic
1176018997 20:62953118-62953140 AGAGCCCCAGGAACACTGGCTGG - Intronic
1178760681 21:35399489-35399511 AGAGAGCCAGGCACTCTCCTCGG + Intronic
1179492591 21:41751051-41751073 AGAGCCCCTGGCACCCACAGGGG + Intronic
1179504492 21:41831588-41831610 AGAGCGCCTGGCTCTCCCGGGGG - Intronic
1179576208 21:42310054-42310076 CGAGCCCCAGGCATGGTCGGGGG - Intergenic
1182510773 22:30818559-30818581 TGTCCCCCAGGCACTCACGGCGG - Intronic
1184428169 22:44425253-44425275 AGGGCCCCAGGCACTTTGGACGG + Intergenic
950531405 3:13554155-13554177 AGAGCCCCAGGCCCACTCTGGGG + Intronic
952356942 3:32593213-32593235 CGAGCCCCAGGCACTCTTGTCGG + Intergenic
954798667 3:53174625-53174647 AGAGGCCCAGGACCTCTCTGAGG + Intronic
955114273 3:55981823-55981845 AGAGCCCCAGCAACTCTCCATGG + Intronic
956162887 3:66373306-66373328 AGGGCCCCAGCCAGTCTCGCAGG - Intronic
962426389 3:135272468-135272490 AGATTCCCAGGCATTCTCTGTGG + Intergenic
962519764 3:136187547-136187569 AGAGTCCCAGCTACTCTAGGAGG + Intronic
966724706 3:183099215-183099237 AAAACCCCAGGCACTTTCGGAGG - Intronic
968464512 4:743809-743831 TGCCCCCCAGACACTCTCGGGGG - Intronic
969157151 4:5221063-5221085 AGAGGTCCAGGCACCCTCAGAGG - Intronic
969407112 4:7000886-7000908 AGAGGCCCAGGCACGCTCTGGGG - Intronic
969443559 4:7231879-7231901 AGAGACCCAGGCTCTCGGGGTGG + Intronic
969594653 4:8142213-8142235 TGAGACCCAGACACTCTGGGAGG - Intronic
969892020 4:10268769-10268791 AGAGCCCCTGACACTATCTGGGG - Intergenic
982274247 4:153623097-153623119 AGAGCCCCAGGCACTCTCGGTGG + Intronic
984991615 4:185386717-185386739 AGAGTCCCAGGCACTGCTGGAGG - Intronic
985508398 5:298359-298381 TGAGCACCAGGCACTGTCAGGGG + Intronic
985739648 5:1607309-1607331 TGAGCACCAGGCACTGTCAGGGG - Intergenic
986280238 5:6316395-6316417 AGAGCCCAAGGCCCTCCTGGGGG - Intergenic
996383129 5:122882567-122882589 AGAGCCCCAAGCATTCACAGTGG - Intronic
997383715 5:133456144-133456166 AGGACCCCAGGGACTCTTGGAGG + Intronic
997721149 5:136079311-136079333 AGAGCCCCAGGGACTGCTGGCGG - Intergenic
999175228 5:149627335-149627357 AGAGACCCGGGCACTCTTGTGGG + Intronic
1002485172 5:179530310-179530332 GGAGCCCCAGGCACTTGTGGGGG - Intergenic
1007026544 6:38581521-38581543 AGAGTCCCAGGCACAATTGGTGG - Intronic
1008895955 6:56555444-56555466 AGTGGCCCAGGCACTCTGTGAGG - Exonic
1012021826 6:93932079-93932101 AGAGCACCAGGCACTATTGCAGG + Intergenic
1012684554 6:102229129-102229151 AAAGCACCAGGCACTCTCTTTGG + Intergenic
1014384010 6:120779299-120779321 AGAGCCCCAGGCAGAATCTGTGG + Intergenic
1018442839 6:163828881-163828903 AGGGCCCCAGGCAATCCCTGTGG + Intergenic
1019642657 7:2112683-2112705 AGGGCCCCAGGGCCCCTCGGTGG - Intronic
1020017286 7:4838427-4838449 GGAGCCCCTGGGACTCTAGGAGG - Intronic
1020253369 7:6486809-6486831 CCAGCCCCAGGCACACTCCGTGG - Intergenic
1026242483 7:68588837-68588859 AGAGCTCCCAGCACTCTGGGAGG - Intergenic
1026848622 7:73711470-73711492 ACAGCCCCAGGCACTCGGTGGGG - Intronic
1026982102 7:74532890-74532912 AGAGCCCAAGGCTCTGTCCGTGG + Intronic
1030304078 7:108002310-108002332 AGAGCCCCAGGGACTGTCCATGG - Intronic
1031589339 7:123570418-123570440 ACAGTCCCTGCCACTCTCGGTGG - Intronic
1033227151 7:139571294-139571316 AGAGCTCCAGGCTCTCGTGGAGG + Exonic
1034064836 7:148126382-148126404 AGAGCCCCAGAAAATCTAGGTGG + Intronic
1035240394 7:157525499-157525521 AGAGCCGTGTGCACTCTCGGAGG + Intergenic
1040547122 8:48407345-48407367 GGAGCCCCACTCACTCTCTGGGG + Intergenic
1049243129 8:141548761-141548783 GGAGCCCCAGGCACTCTGGAAGG - Intergenic
1049474120 8:142789030-142789052 AGAGCTCCAGGCACGTTCTGGGG + Intergenic
1051341259 9:16113013-16113035 TGAGCCCCTGGCACTATCAGGGG - Intergenic
1056773469 9:89496172-89496194 AGGACCCCAGGCACTCAGGGGGG + Intronic
1056792956 9:89638016-89638038 AGAGCTCCAGGCCCTCTGAGGGG - Intergenic
1057298193 9:93861349-93861371 AGAGCCCCAGGCACTTTCCGCGG - Intergenic
1057732444 9:97622116-97622138 AGACCCTCAGGCATTATCGGGGG - Intronic
1058977748 9:110140482-110140504 CTAGCCCCAGGCACTCTCAGTGG + Intronic
1059975051 9:119707242-119707264 AGGGCCCAAGGTACGCTCGGTGG + Intergenic
1060176382 9:121499981-121500003 AGAGGCCCAGCCACTCTCACCGG - Intergenic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1062261057 9:135663600-135663622 AGGGCCCCAGTCACTCTCCCAGG - Intronic
1062411772 9:136429379-136429401 CGGACCCCAGCCACTCTCGGGGG - Exonic
1062622646 9:137429689-137429711 AGAGACGCAGGGACTCTGGGAGG - Intronic
1186600929 X:11036433-11036455 AGAGCTCCAGGCAGTCCCAGTGG - Intergenic
1188065194 X:25650284-25650306 TGAGCCCCAAGAACTCTCTGTGG - Intergenic
1199840820 X:151646164-151646186 AAAGTCACAGGCACTCTGGGAGG - Intronic