ID: 982276312 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:153640022-153640044 |
Sequence | GTGTCTAAAGCGAGGGTGGG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
982276307_982276312 | -6 | Left | 982276307 | 4:153640005-153640027 | CCTTTGGTCTGTTGACAGTGTCT | No data | ||
Right | 982276312 | 4:153640022-153640044 | GTGTCTAAAGCGAGGGTGGGAGG | No data | ||||
982276304_982276312 | 19 | Left | 982276304 | 4:153639980-153640002 | CCGGGCTGGAGACATCAATGGGG | No data | ||
Right | 982276312 | 4:153640022-153640044 | GTGTCTAAAGCGAGGGTGGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
982276312 | Original CRISPR | GTGTCTAAAGCGAGGGTGGG AGG | Intergenic | ||
No off target data available for this crispr |