ID: 982276312

View in Genome Browser
Species Human (GRCh38)
Location 4:153640022-153640044
Sequence GTGTCTAAAGCGAGGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982276307_982276312 -6 Left 982276307 4:153640005-153640027 CCTTTGGTCTGTTGACAGTGTCT No data
Right 982276312 4:153640022-153640044 GTGTCTAAAGCGAGGGTGGGAGG No data
982276304_982276312 19 Left 982276304 4:153639980-153640002 CCGGGCTGGAGACATCAATGGGG No data
Right 982276312 4:153640022-153640044 GTGTCTAAAGCGAGGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982276312 Original CRISPR GTGTCTAAAGCGAGGGTGGG AGG Intergenic
No off target data available for this crispr