ID: 982277541

View in Genome Browser
Species Human (GRCh38)
Location 4:153651878-153651900
Sequence TCACTTACAAGCTGTGACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982277541_982277542 -7 Left 982277541 4:153651878-153651900 CCTATGTCACAGCTTGTAAGTGA No data
Right 982277542 4:153651894-153651916 TAAGTGACACAGCACACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982277541 Original CRISPR TCACTTACAAGCTGTGACAT AGG (reversed) Intergenic
No off target data available for this crispr