ID: 982277542

View in Genome Browser
Species Human (GRCh38)
Location 4:153651894-153651916
Sequence TAAGTGACACAGCACACACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982277541_982277542 -7 Left 982277541 4:153651878-153651900 CCTATGTCACAGCTTGTAAGTGA No data
Right 982277542 4:153651894-153651916 TAAGTGACACAGCACACACAAGG No data
982277540_982277542 -6 Left 982277540 4:153651877-153651899 CCCTATGTCACAGCTTGTAAGTG No data
Right 982277542 4:153651894-153651916 TAAGTGACACAGCACACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982277542 Original CRISPR TAAGTGACACAGCACACACA AGG Intergenic
No off target data available for this crispr