ID: 982278240

View in Genome Browser
Species Human (GRCh38)
Location 4:153658691-153658713
Sequence GGGGCATCTGGACCACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982278237_982278240 -9 Left 982278237 4:153658677-153658699 CCCTTGATGGAGAAGGGGCATCT 0: 2
1: 0
2: 0
3: 23
4: 261
Right 982278240 4:153658691-153658713 GGGGCATCTGGACCACAAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 146
982278231_982278240 26 Left 982278231 4:153658642-153658664 CCATGGAGACAGGTGTGCGCATC No data
Right 982278240 4:153658691-153658713 GGGGCATCTGGACCACAAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 146
982278238_982278240 -10 Left 982278238 4:153658678-153658700 CCTTGATGGAGAAGGGGCATCTG No data
Right 982278240 4:153658691-153658713 GGGGCATCTGGACCACAAGCAGG 0: 1
1: 0
2: 0
3: 14
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982278240 Original CRISPR GGGGCATCTGGACCACAAGC AGG Intergenic
902148738 1:14425294-14425316 GGGGCATCTGGAACACTGGTTGG + Intergenic
903773410 1:25778170-25778192 GGGGATTCTGGACCACAAGATGG + Exonic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
905804440 1:40865561-40865583 GGGGTATCTGGGGCAAAAGCGGG + Intergenic
907012202 1:50974153-50974175 GGGGCATCGGAACCATAAGGGGG + Exonic
913984463 1:143552431-143552453 GGAGCAACTGGAACACCAGCTGG + Intergenic
915472821 1:156136044-156136066 GGAGCTTCTGGACATCAAGCTGG + Exonic
915721875 1:157992067-157992089 GATGCGTCTGGACCACAGGCTGG + Intergenic
917721676 1:177791949-177791971 GTGGAATCAGGACCACAACCCGG - Intergenic
920095530 1:203484060-203484082 GGGACAGGTGGAGCACAAGCAGG - Exonic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
923460722 1:234207102-234207124 GAGTCATCCGGAACACAAGCAGG + Intronic
1065895557 10:30160336-30160358 GGAGCAACTGGACTAGAAGCAGG + Intergenic
1069810334 10:71154766-71154788 AGGGCATAGGGACCAGAAGCTGG + Intergenic
1073002945 10:100298809-100298831 GGGCAAACTGAACCACAAGCTGG + Exonic
1074883065 10:117673297-117673319 GGGACATGTGGACCAAAAGAGGG + Intergenic
1075136397 10:119789823-119789845 GGGGCACCTAGACATCAAGCAGG + Intronic
1076778183 10:132709592-132709614 GTGGCAGCTGGGCCACAGGCTGG + Intronic
1077014178 11:392686-392708 GCGGGATCCGGACCACGAGCCGG + Intronic
1077466831 11:2737361-2737383 GGGGCATGTGCACCTCAAGTGGG + Intronic
1078298433 11:10100359-10100381 GGGGCTACTGAACCACAGGCAGG - Intronic
1078447214 11:11413337-11413359 GGGGCATCTGCACCTCCAGAGGG - Intronic
1081370600 11:42296648-42296670 GGGGCATCTGGAAAACAATTAGG - Intergenic
1089152472 11:116374570-116374592 GGGGCATGTGGAGCATCAGCAGG - Intergenic
1089903094 11:122009297-122009319 GGGCCAACTGGACCACAACATGG - Intergenic
1090208629 11:124899580-124899602 GGGGCAGATGGACCACTAGGTGG + Intergenic
1091207688 11:133832840-133832862 TGGGCCTCTGGACCACAACAAGG - Intergenic
1092042024 12:5393577-5393599 GGAACCTCTGGACCACCAGCTGG + Intergenic
1095291023 12:40480471-40480493 GGGGCAACTGGACCATCAGCTGG + Exonic
1095291093 12:40481188-40481210 GGGACAACTGGAGCACCAGCTGG + Exonic
1095291275 12:40482895-40482917 GGGACAACTGGACCATTAGCTGG + Exonic
1095291280 12:40482925-40482947 GGGACAACTGGACCATCAGCTGG + Exonic
1095291352 12:40483465-40483487 GGGACAACTGGACCATCAGCTGG + Exonic
1095291372 12:40483615-40483637 GGGACAACTGGACCATCAGCTGG + Exonic
1095291456 12:40484182-40484204 GGGACAACTGGATCACTAGCTGG + Exonic
1095291519 12:40484572-40484594 GGGACAACTGGACCATCAGCTGG + Exonic
1095291728 12:40486034-40486056 GGGGCAACTGGACCATTAGCTGG + Exonic
1095291855 12:40486931-40486953 GGGACAACTGGACCATCAGCTGG + Exonic
1095291879 12:40487081-40487103 GGGACAACTGGACCATCAGCTGG + Exonic
1095291886 12:40487141-40487163 GGGACAACTGGACCATTAGCTGG + Exonic
1095291978 12:40487741-40487763 GGGACAACTGGACCATCAGCTGG + Exonic
1095292030 12:40488131-40488153 GGGACAGCTGGACCATTAGCTGG + Exonic
1095292129 12:40488731-40488753 GGGACAACTGGACCATCAGCTGG + Exonic
1095292151 12:40488881-40488903 GGGACAACTGGACCATCAGCTGG + Exonic
1095292283 12:40489871-40489893 GGGACAACTGGACCATCAGCTGG + Exonic
1095292295 12:40489961-40489983 GGGACAACTGGACCATCAGCTGG + Exonic
1096533879 12:52258573-52258595 CGGGCGGCTGGACCCCAAGCCGG + Intronic
1100179774 12:92072788-92072810 GGGGCATCTGTGCTACAAACTGG - Intronic
1101013945 12:100480159-100480181 GTGCCATCAGGAGCACAAGCAGG - Intronic
1101148706 12:101865509-101865531 GGGGCTACTGAACCACAGGCAGG + Intergenic
1104319616 12:127738432-127738454 GGGGCACCAGGAACCCAAGCCGG - Intergenic
1104417385 12:128606593-128606615 GGGGCAGCTGCACCACAGCCAGG - Intronic
1104947538 12:132423320-132423342 GGGGCCTCTGCACCACCTGCAGG + Intergenic
1106011471 13:25828023-25828045 CGGGAATGTGGACCACCAGCTGG - Intronic
1109814962 13:67569414-67569436 GGACCATGTGGACCACAAGGAGG + Intergenic
1112388815 13:98964201-98964223 GTGGCATCTGGCCCACTAGAAGG + Intronic
1117247719 14:53902268-53902290 GGGCCCTCTGGACCAAAAGATGG - Intergenic
1118815772 14:69312892-69312914 AGGACATCTGAGCCACAAGCTGG + Intronic
1120884300 14:89440100-89440122 GGGGTACCTGGGCCTCAAGCAGG + Intronic
1121001773 14:90456278-90456300 TGGGCATCTGGAGCACAGGGAGG + Intergenic
1122594278 14:102878715-102878737 GGAGCATGTGGACCCTAAGCTGG + Intronic
1124357122 15:29003992-29004014 GGGGCTCCAGGACCAAAAGCTGG + Intronic
1129624893 15:77186820-77186842 GGGGAATCTGTACCAGATGCAGG + Intronic
1129824198 15:78624073-78624095 GGGGCATCTGGACTTGAAGGAGG + Intergenic
1129989273 15:79947993-79948015 TGGGCATCTGGACTACAATAAGG + Intergenic
1130094617 15:80846674-80846696 GTGGCATCGGGACCACCGGCAGG - Intronic
1130561630 15:84963609-84963631 GGGGCAGCTGGACCCCAGGTAGG - Intergenic
1133020190 16:2963725-2963747 GCGGCATCTGGACCAGGGGCGGG + Intergenic
1134440802 16:14298638-14298660 GGGGCTTCCGGACCAAGAGCGGG + Intergenic
1137948859 16:52762659-52762681 CAGGCATCTGGACCACAAAGTGG + Intergenic
1138801838 16:60041391-60041413 GGAGCAACTGGACTACAAGGGGG + Intergenic
1139470294 16:67174678-67174700 GGGGCATGTGGTCCCCGAGCCGG - Exonic
1139937214 16:70579978-70580000 GGGGCTCCAGGACCCCAAGCAGG - Exonic
1141844280 16:86596547-86596569 GGGGCATCTGGGCCACAGAGAGG + Intergenic
1147835994 17:43332256-43332278 GTAGCAACTGGACCAGAAGCAGG + Intergenic
1147964875 17:44189229-44189251 GGGGCATGTGGACCACCTGGTGG + Exonic
1148758046 17:49984833-49984855 GAGGCCTCTGGATCACAAGCAGG - Intergenic
1148820265 17:50355943-50355965 GGCGCAGCTGGGCCACAAGCGGG - Exonic
1150096569 17:62381452-62381474 AGGGCTTATGGACCAGAAGCTGG - Intronic
1150657503 17:67049803-67049825 AGGGCAGCTGGACCAGAAGCTGG + Intronic
1152867430 17:82732547-82732569 GTGGGATGTGGACCTCAAGCTGG - Intergenic
1157498007 18:48170323-48170345 GGGGCATCTGGACCTGAACAGGG + Intronic
1157965398 18:52203146-52203168 GTGGCACCTAGACCCCAAGCAGG + Intergenic
1158805027 18:60961376-60961398 GGGTGATCTGGATCACAAACTGG - Intergenic
1158956168 18:62541256-62541278 GGGGAAACTGGCCCACAAGCAGG + Intronic
1162453776 19:10770086-10770108 GGCGCAACGGGACCACACGCAGG + Intronic
1163753382 19:19092029-19092051 GAGGCAGCTGGAACAGAAGCAGG + Intronic
1165677079 19:37735692-37735714 GGGGCATTGGGACCACAAACTGG + Intergenic
1167040414 19:47020181-47020203 GGGGCATCTGGACACCTGGCTGG + Intronic
1167510459 19:49893045-49893067 GGGGCATGTGGACCACCATGAGG + Intronic
926884555 2:17585254-17585276 GGAGGGTGTGGACCACAAGCTGG - Intronic
928616813 2:33048630-33048652 CTGGCATCTGGACCACAGGAAGG - Intronic
930754129 2:54958644-54958666 GGGGCATCTGTGGCACAAGAGGG - Intronic
939594077 2:144103296-144103318 GGGGCCACTGGAGCACAAGAGGG + Intronic
940317044 2:152336340-152336362 GGGGCATCTGAAACCCAGGCCGG + Intronic
940400192 2:153240450-153240472 AGGGCTACTGAACCACAAGCAGG - Intergenic
946370987 2:219281160-219281182 GGGGAAACTGGAGGACAAGCAGG + Intronic
946616868 2:221519357-221519379 GGGGCATTTGGACCTTAAGTCGG + Intronic
1169492650 20:6084116-6084138 GGGGCATCTGGGCCACGTTCTGG + Exonic
1170816834 20:19721014-19721036 GTGGCAGCTGGACAAGAAGCTGG + Exonic
1173215419 20:41077473-41077495 GGGACATCATGATCACAAGCTGG - Intronic
1174158249 20:48531246-48531268 GGGGCATCTGGACCAAGTGAAGG + Intergenic
1175265905 20:57703413-57703435 GGGGCATCTGGACGTCAGGGCGG + Intronic
1176181336 20:63751277-63751299 GGGGCCCCTGGACCACGAGATGG - Intronic
1179981655 21:44899126-44899148 GGGCCAGCTGGCGCACAAGCTGG - Exonic
1180058735 21:45374127-45374149 GGTGCAGCTGGACCACAGCCAGG + Intergenic
1181044868 22:20209739-20209761 GGGCCACCTGGACCGAAAGCTGG - Intergenic
1181098115 22:20520092-20520114 GGGACATCTGGGCCAAAGGCAGG + Intronic
1183019057 22:35012702-35012724 GTGGCATCAGGGCCAAAAGCAGG + Intergenic
1184149586 22:42630492-42630514 GGGGCGTCTGTACCGCCAGCCGG + Intronic
949999006 3:9641980-9642002 GGGGCTACTGAACCACAGGCAGG + Intergenic
950510920 3:13426056-13426078 AGGGCCTGGGGACCACAAGCAGG - Intergenic
954116174 3:48468032-48468054 GGGCCATCTGGACCAAAGGTGGG - Exonic
959502721 3:107125003-107125025 GGGCCATCTGGAGCACAGGCTGG + Intergenic
961035732 3:123640359-123640381 CGTGCACCTGGACCTCAAGCCGG - Exonic
965522045 3:169678030-169678052 GGGGCTTCTGGGCCAGTAGCAGG - Intergenic
968540247 4:1164671-1164693 GGGGCACCTGGGCCAGAAGGAGG - Intergenic
968904507 4:3445180-3445202 GGGGCATCGGAACCCCCAGCAGG - Intronic
979158670 4:117430065-117430087 CAGGCCTCTGGACCACCAGCAGG - Intergenic
982278240 4:153658691-153658713 GGGGCATCTGGACCACAAGCAGG + Intergenic
985146183 4:186896359-186896381 GGGGCATCTGGCCCACCTACAGG - Intergenic
987039255 5:14046379-14046401 GGGCCACCTGCACCACAGGCTGG + Intergenic
987148623 5:15017035-15017057 ATGGCATCTGGTCCAGAAGCTGG - Intergenic
990833071 5:59982485-59982507 GGGGCACATGGACCACATGTGGG + Intronic
996823166 5:127652966-127652988 TGGGCATCAGGCCCACAAGGGGG + Intronic
1006090117 6:31623716-31623738 GGGGCAACTGGAGAACAAGACGG - Exonic
1007485679 6:42179066-42179088 GGGGCCCCTGGACCAGAATCTGG + Intronic
1013973350 6:116046941-116046963 GGGGCATCAGGACCACAACTTGG - Intronic
1017868611 6:158467097-158467119 TGAGCAGCTGGACCACAACCTGG - Intronic
1019190489 6:170247976-170247998 GGGGCATCTGGCCCCAATGCCGG + Intergenic
1019427553 7:984614-984636 GGGGCACCTGGACCCCAGGAGGG + Intronic
1019712028 7:2522174-2522196 TGGGCATCTGACCCACATGCTGG + Intronic
1025262954 7:57433071-57433093 GGTGCATCTGGATCACTTGCGGG + Intergenic
1025740705 7:64193199-64193221 TGGGGATCTGGCCCACAAGGTGG + Intronic
1026158593 7:67849304-67849326 GGGGCATGCAGACCACATGCTGG - Intergenic
1026899037 7:74027278-74027300 GGGGCATCTGGAGCACATGGAGG - Intergenic
1030052651 7:105552522-105552544 GTGGCACCTGGACAACAAGCAGG - Intronic
1034026125 7:147706780-147706802 GTGGCATATGGAACACAATCAGG - Intronic
1035759308 8:2057616-2057638 GGGGCAGATGGAGGACAAGCTGG + Exonic
1036694280 8:10964567-10964589 GGGGCATTTGGACAACATCCTGG + Intronic
1036748734 8:11429633-11429655 ATGGCATCTGGACCACACTCGGG + Intronic
1037072776 8:14673049-14673071 GGGTAATCTAGACCAAAAGCTGG - Intronic
1037849831 8:22318191-22318213 GCGGCATCTGGAACACCACCCGG - Exonic
1039586899 8:38714434-38714456 GACGCATTTGGACCACTAGCTGG - Intergenic
1041189291 8:55337260-55337282 GGGGTTTCTGGAACCCAAGCTGG + Intronic
1041756719 8:61321913-61321935 GGGGAATCTGGAGTACAAGTAGG - Intronic
1042614939 8:70638372-70638394 AGGGCCAGTGGACCACAAGCTGG - Intronic
1049583196 8:143421899-143421921 GGGGCATCTGTACCAAGAGCTGG + Intronic
1052716053 9:32118679-32118701 AGGGTATCTGGACCAGAAGCTGG - Intergenic
1056702966 9:88925974-88925996 GGGGCATCTGGGCAGCAGGCGGG - Intergenic
1057211852 9:93204820-93204842 GGGGTATGGGGACCCCAAGCTGG + Intronic
1059393882 9:114018258-114018280 TGGGCATCAGCACCACAAGTGGG - Intronic
1062331275 9:136045966-136045988 GGGGCATCTGAACGTCCAGCAGG - Intronic
1187386406 X:18852556-18852578 GAGGCCTGTGGACCAGAAGCCGG + Intergenic
1188789291 X:34388358-34388380 GAGGCTTCTGGACCAGGAGCTGG - Intergenic
1189050719 X:37642401-37642423 TGAGCATCTGTACCACAACCAGG - Intronic
1192191061 X:68991427-68991449 GGGGCCTCTGGGGCACAAGTGGG - Intergenic
1192758179 X:74067284-74067306 GGGCCATCTGGACCAAAGGTGGG + Intergenic
1197773814 X:130107375-130107397 GGTGCATCTAGACCAGAATCTGG + Intronic
1198596710 X:138243812-138243834 GGGGCATTTGGAGCAAAGGCAGG + Intergenic
1199639447 X:149846358-149846380 GGGGCATATGGACCAAATGGGGG + Intergenic