ID: 982281015

View in Genome Browser
Species Human (GRCh38)
Location 4:153684017-153684039
Sequence CCTTGCACGGGGCAGCTGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982281004_982281015 2 Left 982281004 4:153683992-153684014 CCCCCAGCTCTCTTCTTCGACCC No data
Right 982281015 4:153684017-153684039 CCTTGCACGGGGCAGCTGTCGGG No data
982281002_982281015 10 Left 982281002 4:153683984-153684006 CCGCCAAGCCCCCAGCTCTCTTC No data
Right 982281015 4:153684017-153684039 CCTTGCACGGGGCAGCTGTCGGG No data
982281006_982281015 0 Left 982281006 4:153683994-153684016 CCCAGCTCTCTTCTTCGACCCAG No data
Right 982281015 4:153684017-153684039 CCTTGCACGGGGCAGCTGTCGGG No data
982281005_982281015 1 Left 982281005 4:153683993-153684015 CCCCAGCTCTCTTCTTCGACCCA No data
Right 982281015 4:153684017-153684039 CCTTGCACGGGGCAGCTGTCGGG No data
982281001_982281015 13 Left 982281001 4:153683981-153684003 CCTCCGCCAAGCCCCCAGCTCTC No data
Right 982281015 4:153684017-153684039 CCTTGCACGGGGCAGCTGTCGGG No data
982281007_982281015 -1 Left 982281007 4:153683995-153684017 CCAGCTCTCTTCTTCGACCCAGC No data
Right 982281015 4:153684017-153684039 CCTTGCACGGGGCAGCTGTCGGG No data
982281000_982281015 20 Left 982281000 4:153683974-153683996 CCTGGAACCTCCGCCAAGCCCCC No data
Right 982281015 4:153684017-153684039 CCTTGCACGGGGCAGCTGTCGGG No data
982281003_982281015 7 Left 982281003 4:153683987-153684009 CCAAGCCCCCAGCTCTCTTCTTC No data
Right 982281015 4:153684017-153684039 CCTTGCACGGGGCAGCTGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982281015 Original CRISPR CCTTGCACGGGGCAGCTGTC GGG Intergenic
No off target data available for this crispr