ID: 982284444

View in Genome Browser
Species Human (GRCh38)
Location 4:153720345-153720367
Sequence ATTTCCAAACAGCTGGAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 184}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982284444 Original CRISPR ATTTCCAAACAGCTGGAGTT TGG Intronic
900859754 1:5219747-5219769 ATCTCCACAGAGCTGGAGGTGGG + Intergenic
901092530 1:6651592-6651614 CTTTTCAAACAGTTGGAATTTGG - Exonic
901125738 1:6927435-6927457 ATTTTCAAACAGCTATTGTTAGG - Intronic
901921596 1:12541080-12541102 AATTCCTGACAGCGGGAGTTGGG - Intergenic
906737626 1:48146888-48146910 ATTTGCAAACAGGGAGAGTTTGG - Intergenic
907733365 1:57088616-57088638 AATCCCAAAAAGCTGGAGGTGGG - Intronic
910081563 1:83348089-83348111 ATTATAAAACAGCTGAAGTTAGG + Intergenic
910135805 1:83967811-83967833 ATTTCCAAAACGCTGGAATGAGG + Intronic
911037034 1:93561539-93561561 ACTTGCTACCAGCTGGAGTTAGG - Intergenic
912422745 1:109556648-109556670 AGTTCCCAACAGGTGGATTTGGG - Intronic
913173988 1:116257162-116257184 TTGTCCAAACAGCAGCAGTTAGG - Intergenic
914816309 1:151065540-151065562 AATCCCAAACTGATGGAGTTAGG + Intronic
915436943 1:155914186-155914208 TTTTCCACAGGGCTGGAGTTTGG - Exonic
915685760 1:157631350-157631372 ATTTCAAAACAGGTGGTTTTAGG + Intergenic
916284186 1:163086323-163086345 AATTCCAAATCTCTGGAGTTGGG - Intergenic
917622526 1:176811357-176811379 ATTTGTAAACAGCTGAAGTGTGG - Intronic
918643473 1:186873291-186873313 ATTACCAAATAGCTGAATTTGGG + Intronic
920601111 1:207324772-207324794 ATTTTCAACCATCTGGTGTTTGG + Intronic
921327348 1:213999184-213999206 AGTTAAAAATAGCTGGAGTTCGG - Intronic
923380648 1:233414490-233414512 ATTTCCTAAATGCTGGATTTTGG + Intergenic
1063290799 10:4745291-4745313 ATTGGGAAACAGCTGGTGTTTGG + Intergenic
1064296695 10:14085104-14085126 ATTTATAAACAGATGGAGGTGGG - Intronic
1065323724 10:24532423-24532445 ATTTCCAAAGAGATGCAGTATGG + Intronic
1066723739 10:38367820-38367842 ATTTCTATACAGCTTGAGTGGGG - Intergenic
1068436363 10:56996273-56996295 AGTTCCAAAAAGCTGGACATAGG + Intergenic
1070381520 10:75884746-75884768 ATTTCCAAAGTGGTGGAGTCAGG + Intronic
1070672025 10:78384607-78384629 ATGACCAATCAGTTGGAGTTGGG - Intergenic
1072363993 10:94690187-94690209 ATTTTAAAACAACTGGATTTGGG + Intronic
1077522441 11:3044300-3044322 ATCTCCACACAGCTGGCGATGGG + Intronic
1079102312 11:17549343-17549365 ATTTCCAAAGGGCAGGAGTTGGG - Intronic
1079898696 11:26153865-26153887 ATTTCAAAACAGCTAGAAGTGGG + Intergenic
1080075041 11:28139049-28139071 AGTTCTTAACAGCTGGACTTCGG - Intronic
1081741413 11:45443580-45443602 CTCTCCCAACAGCTGGATTTTGG - Intergenic
1084193576 11:67510203-67510225 TTTTCCTAATGGCTGGAGTTAGG - Intergenic
1085246784 11:75108363-75108385 AATGTCACACAGCTGGAGTTAGG - Intronic
1086426335 11:86687264-86687286 ATAGCACAACAGCTGGAGTTAGG - Intergenic
1086750314 11:90485601-90485623 ATTAAAAAACTGCTGGAGTTTGG + Intergenic
1088015602 11:105055253-105055275 ATTTCCAAAAAGCAGAAGTGAGG - Intronic
1088502635 11:110497924-110497946 ACTTCCCAACAGCAGGTGTTGGG + Intergenic
1093078854 12:14786784-14786806 ATTTCCAAAGAACTGGAGGAGGG + Exonic
1094363111 12:29651314-29651336 GTTTCCAAACAGTTGGTGGTGGG + Intronic
1096463289 12:51834610-51834632 AATGCCAAACAGCAGGAGGTCGG + Intergenic
1096736571 12:53660197-53660219 ATCTCCCAACATCTGGAGTAGGG - Intronic
1096779454 12:53983768-53983790 CTTTCCGAAGGGCTGGAGTTTGG - Intergenic
1098467212 12:70801196-70801218 AGTTGGAAACAGATGGAGTTGGG + Intronic
1099919707 12:88942255-88942277 CTTTCCAATCAGTTGGATTTGGG + Intergenic
1100218555 12:92479292-92479314 CTTTGCAAACAGATGGAATTTGG - Intergenic
1100781027 12:98026452-98026474 ATGCCAAAACAGATGGAGTTTGG + Intergenic
1101734042 12:107449497-107449519 ATTCCAAAACAGCTGAAGATGGG - Intronic
1102642712 12:114381122-114381144 TTTTCCAAACACAGGGAGTTGGG + Intronic
1103165193 12:118764498-118764520 ATGGCCACACAGCTGGAATTGGG - Intergenic
1103828319 12:123758427-123758449 ATTTTCCAACAGCTGAAGTAGGG + Exonic
1104438010 12:128771276-128771298 ATTTCTATACAGCTTCAGTTAGG + Intergenic
1105746501 13:23381800-23381822 ATTTCTAAATATTTGGAGTTAGG + Intronic
1108029353 13:46212389-46212411 ATTTCTAAACAGTATGAGTTGGG + Intronic
1108159268 13:47620856-47620878 GTGTCCAAATGGCTGGAGTTGGG - Intergenic
1108631828 13:52291807-52291829 ATTGCCATAAAGTTGGAGTTGGG - Intergenic
1108654867 13:52520786-52520808 ATTGCCATAAAGTTGGAGTTGGG + Intergenic
1109142990 13:58739657-58739679 ATTTCCTAACAGCCAGATTTTGG + Intergenic
1110305048 13:73976542-73976564 AATTGCAAACAACTGGAGTAGGG - Intronic
1114836480 14:26208820-26208842 ATTTCCTAAAATCTGGACTTTGG - Intergenic
1115506319 14:34097509-34097531 ATTTGGAAATAGCTGTAGTTTGG - Intronic
1116559357 14:46358878-46358900 ATTTCAAAACAGCTAGAGGAGGG + Intergenic
1117523111 14:56570818-56570840 AATTCAAAAGAGCTGTAGTTTGG + Intronic
1119967550 14:78933956-78933978 ATTTACAAACAGCTGAAGATGGG - Intronic
1121541109 14:94727383-94727405 ATTTCCAAGCCCCTGGAATTGGG - Intergenic
1121797673 14:96748620-96748642 GCTTCCCAACAGCTGGAGTCTGG - Intergenic
1122162472 14:99793910-99793932 ATTTCCAAACAGATGTGGGTCGG - Intronic
1126716519 15:51524318-51524340 ATAACCCAACAGCTGGAGGTAGG + Intronic
1127171677 15:56309882-56309904 AATCCCAAAAAGCTGGAGGTGGG + Intronic
1129179551 15:73865326-73865348 ATTTGCAAACAGATGGAGTTGGG + Intergenic
1129951032 15:79591812-79591834 AGTTCATAACAGCTGGAATTTGG - Intergenic
1130999985 15:88932269-88932291 CTTTCCAAATCGATGGAGTTAGG - Intergenic
1131154214 15:90064990-90065012 ATTTCCCAGCAGCTGGACATTGG + Intronic
1131251880 15:90836421-90836443 TCTTCTGAACAGCTGGAGTTGGG + Intergenic
1131383457 15:91983066-91983088 ATTTCCATTAAGCTGGAGATGGG + Intronic
1131497501 15:92925734-92925756 AGGTCCAAACAGAAGGAGTTAGG - Intronic
1131516497 15:93081111-93081133 GGTGCCACACAGCTGGAGTTAGG - Intronic
1131741332 15:95396027-95396049 ATTTTAAAACACCTTGAGTTTGG - Intergenic
1136011534 16:27366733-27366755 GTCTCCAAACAGCTCTAGTTGGG + Intergenic
1137820412 16:51439314-51439336 ACTTCCAAGCAGTTGGATTTAGG + Intergenic
1143307367 17:5958131-5958153 ATTTTCAAACTGGTGGAGTTCGG - Intronic
1153906365 18:9665245-9665267 GTTTCTAAACAGCTGGAGAAAGG + Intergenic
1154023960 18:10689499-10689521 ATTTCCAACCCACTAGAGTTGGG - Intronic
1155702399 18:28763265-28763287 ATTTCAAAACAGCCAGACTTAGG - Intergenic
1156754176 18:40500777-40500799 ATTTCCAAACATCTGGACTTTGG - Intergenic
1158152468 18:54387975-54387997 ATTTTCAGGCAGTTGGAGTTGGG - Intergenic
1161289929 19:3488190-3488212 AGCTTCAAACAGCTGGACTTGGG - Intergenic
1162677376 19:12309650-12309672 ATTTCTAGACAGCAGGGGTTGGG + Intergenic
1166078629 19:40429137-40429159 TTTTCCAATAAGCTGGAGGTTGG + Intergenic
925019960 2:560639-560661 ATTACAAAACAACTGGAGGTGGG - Intergenic
925302894 2:2829552-2829574 ATTTCTAAACAAATGGAGTTGGG - Intergenic
929216754 2:39422373-39422395 GTTTCCAAACATGAGGAGTTTGG - Intronic
929875531 2:45793428-45793450 GTTTCCAAAGAGCAGGATTTGGG - Intronic
930763739 2:55062917-55062939 TATTCCATACAGCTGGAGTCAGG - Intronic
931831291 2:66054184-66054206 ATTTACATACAGCTGGGATTTGG - Intergenic
932087044 2:68771715-68771737 AGTTCCACACTGCTGGAATTAGG - Intronic
937816951 2:126261201-126261223 TTTTCAAAGCAACTGGAGTTTGG - Intergenic
937936601 2:127250346-127250368 ATTTCCAAAGAACTGGAGAAGGG - Intergenic
941090957 2:161175073-161175095 ATATCCAAAAGGCTAGAGTTTGG - Intronic
942654906 2:178205076-178205098 ATTTACAAACTGCAGGAGCTTGG - Intronic
943010850 2:182447281-182447303 ATTTCCAAGCAGATGAAGCTGGG + Intronic
945103352 2:206284454-206284476 ATTTCCAAACAGTTGAAGAGAGG - Intronic
1171002951 20:21433328-21433350 GATTCCAAAAAGCTGGAGCTGGG + Intergenic
1172018968 20:31899304-31899326 CATTCCAAACAGCAGGAGGTAGG + Intronic
1173487952 20:43455539-43455561 ATATCCAAAGAGCTGGTGTTGGG + Intergenic
1173955085 20:47025677-47025699 ATTTCCAAAAAGTAGGAGTTGGG + Intronic
1174451919 20:50625831-50625853 ATTTCCCAAGAGCTGGACCTGGG - Intronic
1181958617 22:26606708-26606730 ATGTCAAAACAGCTGGTGGTTGG + Intronic
1182656719 22:31896452-31896474 ATTTCCAAAAAAATAGAGTTGGG - Intronic
1184367928 22:44064238-44064260 GCTTCCAAACAGCTGGGTTTCGG - Intronic
949246283 3:1928486-1928508 ATTTCAAAATAGCTAGATTTTGG + Intergenic
949333924 3:2952826-2952848 ATTACCAAGCAGCTGTATTTTGG + Intronic
949590858 3:5492704-5492726 ATTTCCAGAAAGATTGAGTTTGG - Intergenic
949757637 3:7431544-7431566 AGAGCCAAACAGCTGGAGTTCGG + Intronic
951462011 3:22961406-22961428 ATTTCCAAGTAGCAGCAGTTGGG + Intergenic
952930937 3:38360690-38360712 TTTTCCAAACATCTGCAGTCAGG + Intronic
953517609 3:43611093-43611115 TTTTCCACACAGTTGGAGTTAGG + Intronic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
955451388 3:59071066-59071088 ATTCCCAAACAGCTGCTATTTGG + Intergenic
956004981 3:64769240-64769262 ATTTTCAAATGGCTGGAGTGGGG + Intergenic
956106525 3:65824470-65824492 GTTTTCTAACAGCTGTAGTTTGG - Intronic
956677299 3:71748103-71748125 TTTTCCAAACACCTGAATTTGGG + Intronic
957369930 3:79280484-79280506 GTTTCCAAACAGCTGTAGTTAGG - Intronic
960046589 3:113204555-113204577 AATGTCAAACAGCTGGAGTCTGG + Intergenic
960098686 3:113714534-113714556 ATTTGCAAAGCTCTGGAGTTGGG + Intergenic
960203462 3:114866615-114866637 ATCTCCAAACAGTTGGAGGCTGG + Intronic
962695049 3:137939707-137939729 ATTACCTAATAGTTGGAGTTTGG + Intergenic
963051692 3:141148756-141148778 TTTGCAAAATAGCTGGAGTTTGG - Intergenic
964991563 3:162818979-162819001 TCCTCCAAACACCTGGAGTTGGG + Intergenic
966098600 3:176238558-176238580 ATTTCCAAACAGAAGTAGTGGGG + Intergenic
967517668 3:190389565-190389587 ATTTCAAAACCAATGGAGTTAGG + Intronic
968482411 4:840990-841012 ATTTTCAAATAGCTGGGGGTGGG + Intergenic
976136188 4:81938497-81938519 ATATCCAAAATGCTGGAGTAGGG + Intronic
977328064 4:95602235-95602257 AAGTCCAAACAACTGGGGTTAGG + Intergenic
981573971 4:146184235-146184257 ATTGCCAAACACCTGAATTTTGG + Intronic
982284444 4:153720345-153720367 ATTTCCAAACAGCTGGAGTTTGG + Intronic
982632063 4:157843074-157843096 TTTTCCACACAGGTGGAGTCAGG - Intergenic
986022282 5:3815517-3815539 ATATCCTCACATCTGGAGTTAGG + Intergenic
987186084 5:15420386-15420408 ATTTCTAAATATCTGGAATTTGG - Intergenic
990682610 5:58262319-58262341 ATTTTCTAACATCTGGTGTTGGG + Intergenic
992753955 5:79886835-79886857 TATAACAAACAGCTGGAGTTAGG - Intergenic
994059587 5:95459572-95459594 ATTTCCAAACTTCTGAAGCTAGG + Intergenic
995821171 5:116234684-116234706 ATTTACACACAGATCGAGTTAGG + Intronic
998394039 5:141806746-141806768 ATTAGGAAACAGCTGGAATTTGG + Intergenic
1000149682 5:158487342-158487364 ATTTCCACATAGCTGCATTTTGG - Intergenic
1003186838 6:3839438-3839460 CTTTCCACACCGCTGTAGTTTGG - Intergenic
1004041921 6:11987876-11987898 ATTTTCAAATAGTTGGATTTGGG + Intergenic
1005257419 6:24018137-24018159 AGTGCCTAACAGCTTGAGTTGGG + Intergenic
1005487323 6:26313371-26313393 AATTCTAAACCGCTGGTGTTTGG - Intergenic
1006460005 6:34152778-34152800 AATTCTAACCAGCTGGAGTGGGG + Intronic
1008288830 6:49687588-49687610 ATGCCAAAACTGCTGGAGTTGGG + Intergenic
1009352997 6:62706487-62706509 ATTTCCAAATAGCTGTATTGAGG - Intergenic
1015547239 6:134374073-134374095 GTTTCCAACCTGCTGGAGGTGGG - Intergenic
1017043569 6:150326788-150326810 ATTTCCAAAAAGCTATAGTGAGG - Intergenic
1017753039 6:157506392-157506414 ATTTGCAAAGAGCTGGATGTTGG + Intronic
1018656111 6:166037949-166037971 ATCAGCAAACAGCAGGAGTTGGG + Intergenic
1020001250 7:4757206-4757228 CTTTCCTAACAGCTGGAGGACGG - Intronic
1020026920 7:4905779-4905801 ATTTCCCACCAGCTGGGGTCAGG - Intergenic
1020765761 7:12318600-12318622 ATTTCCAAAAAGCTGCATTAAGG + Intergenic
1020920547 7:14258459-14258481 ATTTATAAACAGCTGAAATTAGG + Intronic
1021994643 7:26167953-26167975 ATTTCCAAACAGGTGGTGTGTGG + Intronic
1024002367 7:45199145-45199167 TTCTCCAATCAGCTTGAGTTGGG + Intergenic
1025848822 7:65225522-65225544 ATTTCAAAAGAGGTGGTGTTTGG + Intergenic
1026487116 7:70831023-70831045 ATTTCTAAACAGCAGAAATTGGG - Intergenic
1027299051 7:76810329-76810351 ATTATAAAACAGCTGAAGTTAGG + Intergenic
1027730653 7:81867904-81867926 ATTCACAAATACCTGGAGTTGGG + Intergenic
1028230503 7:88301593-88301615 TTTTCCAGACAGCTGGAGTGCGG + Intronic
1029835690 7:103307186-103307208 ATTTTTAAAAAGCTGGAGCTGGG - Intronic
1030143584 7:106330410-106330432 ATTTCTGAATAGCTGAAGTTAGG + Intergenic
1032027941 7:128458058-128458080 ATCTCCCAACAGCTGAAGTTGGG - Exonic
1033060215 7:138099031-138099053 ATTTCCAAACTTTTGGAGTTTGG - Intronic
1034566812 7:151921981-151922003 ATTTCCTACCATTTGGAGTTGGG - Intergenic
1037575931 8:20202833-20202855 TTTACCAAACAGCTGGGGTGAGG - Intronic
1038740243 8:30210966-30210988 ATTTTAAAATAGCTGCAGTTGGG - Intergenic
1039085776 8:33778099-33778121 GTTTCCAAGCAGATGGAGTTGGG - Intergenic
1041254221 8:55965432-55965454 ATTTGCAGACAACTGGACTTGGG - Intronic
1043049399 8:75365743-75365765 TTTTCTAAACAGCTTGAGTTAGG + Intergenic
1044106488 8:88213893-88213915 ATTTCCAAACATTTGGAATATGG - Intronic
1046337547 8:112809646-112809668 ATTTCCAAACAGCTAGGAATTGG + Intronic
1047030232 8:120869169-120869191 TTTTCCAAAAATCTGGAGTTGGG - Intergenic
1048549335 8:135419527-135419549 CTTTGCAATCAGCTGGAGCTAGG + Intergenic
1050175416 9:2864916-2864938 GTTGCCAAACAACTGGATTTTGG + Intergenic
1050798163 9:9572858-9572880 ATACCCAAACTGCTGAAGTTAGG + Intronic
1052214480 9:25950130-25950152 AATTCAAAACAGCTGCATTTAGG - Intergenic
1055109687 9:72547378-72547400 ATTTCCAAAACAGTGGAGTTTGG + Intronic
1055793376 9:79947553-79947575 ATCTCTACACAGATGGAGTTTGG - Intergenic
1058287241 9:103193401-103193423 GGTTCCACACAGCTAGAGTTGGG + Intergenic
1059633831 9:116153951-116153973 ATTGCCAACCAGGAGGAGTTGGG + Exonic
1062479605 9:136745202-136745224 ATCTTCACTCAGCTGGAGTTCGG - Exonic
1062530244 9:136996511-136996533 CTTGACAAACAGCTGGAGCTTGG + Exonic
1186249909 X:7654722-7654744 AATTAGAAACTGCTGGAGTTTGG - Intergenic
1187382622 X:18818717-18818739 ATTAACAAACAGCTAGATTTTGG + Intronic
1188017947 X:25125535-25125557 ATTTCCAAACAGCAAGGGATTGG - Intergenic
1189717079 X:43878003-43878025 ATTTCCAAAAAGGTAGAGTAAGG + Intronic
1190406893 X:50097251-50097273 ATTTCTAAACATCTGGATCTGGG + Exonic
1194563757 X:95455602-95455624 ATTTCAAAACAGCTAGATATTGG + Intergenic
1196177973 X:112661098-112661120 GTTTAGAAACAGCTGGATTTTGG - Intronic
1196570351 X:117259681-117259703 ACTTAGATACAGCTGGAGTTTGG - Intergenic
1197069188 X:122273367-122273389 ATTTCCAAAGAGAAGGAATTGGG + Intergenic
1197454922 X:126667297-126667319 GTCTCCAAACAGCTATAGTTGGG - Intergenic
1199074726 X:143514374-143514396 ATTTTCTAAAAGCTGGAGTAGGG - Intronic
1200778243 Y:7189813-7189835 ATTTCAAAACAAGTGGGGTTTGG - Intergenic