ID: 982285057

View in Genome Browser
Species Human (GRCh38)
Location 4:153725419-153725441
Sequence AACCATATTCTGGTACTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982285057_982285065 24 Left 982285057 4:153725419-153725441 CCTGCCAGTACCAGAATATGGTT 0: 1
1: 0
2: 0
3: 8
4: 94
Right 982285065 4:153725466-153725488 ACCCATTTCCCTGCCTTAAGGGG 0: 1
1: 0
2: 0
3: 10
4: 122
982285057_982285063 22 Left 982285057 4:153725419-153725441 CCTGCCAGTACCAGAATATGGTT 0: 1
1: 0
2: 0
3: 8
4: 94
Right 982285063 4:153725464-153725486 TGACCCATTTCCCTGCCTTAAGG 0: 1
1: 0
2: 1
3: 12
4: 174
982285057_982285064 23 Left 982285057 4:153725419-153725441 CCTGCCAGTACCAGAATATGGTT 0: 1
1: 0
2: 0
3: 8
4: 94
Right 982285064 4:153725465-153725487 GACCCATTTCCCTGCCTTAAGGG 0: 1
1: 0
2: 0
3: 8
4: 135
982285057_982285060 -1 Left 982285057 4:153725419-153725441 CCTGCCAGTACCAGAATATGGTT 0: 1
1: 0
2: 0
3: 8
4: 94
Right 982285060 4:153725441-153725463 TCCTTGAACTCCGCACACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982285057 Original CRISPR AACCATATTCTGGTACTGGC AGG (reversed) Intronic
909366931 1:74835447-74835469 ATCGATATTGTGGTACTGGGAGG + Intergenic
909781785 1:79557753-79557775 CCCCATATTCTGGTAGTGGTGGG + Intergenic
914975801 1:152360165-152360187 AACCATGTCCTCGTACTGGAAGG - Intergenic
916048556 1:161018932-161018954 AATCATATACTGGCACTGGAAGG - Intronic
921598251 1:217078588-217078610 AACCACACACTGTTACTGGCTGG + Intronic
922182209 1:223244224-223244246 AAGCATATGCTGGTACTAGCAGG + Intronic
922323841 1:224510640-224510662 AACCATATTAATGTCCTGGCCGG + Intronic
924760075 1:246976064-246976086 GACCATCTGCTGATACTGGCTGG + Intronic
1065639122 10:27763729-27763751 AACCAGATTCTGATACTGTGTGG + Intergenic
1066696758 10:38085826-38085848 CACCATAAACTGGTTCTGGCTGG - Intergenic
1078616083 11:12867585-12867607 GCCCATATCCTGGTAATGGCTGG - Intronic
1084877851 11:72146807-72146829 AACCATGGGCTGGTTCTGGCTGG + Intergenic
1087433944 11:98089425-98089447 AAAAATATTCTGATATTGGCTGG - Intergenic
1088431501 11:109764280-109764302 AACCATATTTTTCTCCTGGCAGG - Intergenic
1092964224 12:13626186-13626208 AACCATCTTCTGGGACATGCAGG + Intronic
1094505176 12:31055419-31055441 AGACATGTTCTGGTACAGGCAGG - Intergenic
1094784515 12:33830889-33830911 AACCATATTCTGGAATTCACGGG + Intergenic
1095336496 12:41034365-41034387 GACCTTCTTCTGCTACTGGCAGG - Intronic
1099815440 12:87640709-87640731 AACCATATTTTGGGACCGACTGG + Intergenic
1112215409 13:97425829-97425851 GACCATCTTCTGGTTCTGTCTGG + Intergenic
1112917504 13:104569615-104569637 AAGCATGTCCTGGTACAGGCTGG - Intergenic
1113965691 13:114152312-114152334 AACCATGGTCTGCTACTTGCTGG - Intergenic
1114621772 14:24100293-24100315 AACCATCTTCTAGGACTGCCAGG + Intronic
1117694730 14:58348948-58348970 AAAAATATTCTGGAACTGGACGG - Intronic
1120732206 14:88016428-88016450 AACCATGGACTGGTTCTGGCTGG + Intergenic
1124132089 15:26999378-26999400 AACCATCCTTTGGTATTGGCAGG - Intronic
1127973707 15:63981962-63981984 AACTATGCTCTGGTATTGGCAGG - Intronic
1142707727 17:1707312-1707334 AACCAAATTCTGGCAGTGGGAGG - Exonic
1151725291 17:75880215-75880237 TCCCAGCTTCTGGTACTGGCTGG + Intergenic
1152723080 17:81932318-81932340 AACATTATTCTGTTTCTGGCAGG + Intergenic
1155410823 18:25542676-25542698 AAGCATATTCTGGCAGTGGGAGG + Intergenic
1157358820 18:46960116-46960138 AACTAGATTCTGGTTCTGGAAGG + Intronic
1157793305 18:50552442-50552464 GACCATAGACTGGTTCTGGCTGG + Intergenic
1162686428 19:12388736-12388758 CACCTTATTCTGGTGCTGTCAGG + Intronic
1165286782 19:34849396-34849418 AACCATGGGCTGGTTCTGGCTGG - Intergenic
1167731084 19:51256170-51256192 ACACAGATACTGGTACTGGCTGG - Intronic
925076075 2:1016881-1016903 CACCATGATCTGGTCCTGGCTGG - Intronic
927173996 2:20392599-20392621 AACCAGGTTCTGGGCCTGGCTGG + Intergenic
928536798 2:32249005-32249027 AACCACAGACTGGTTCTGGCTGG + Intronic
932056813 2:68453967-68453989 AACCATGGACTGGTTCTGGCCGG + Intergenic
932181105 2:69646920-69646942 AACCACAGACTGGTTCTGGCTGG + Intronic
932286301 2:70534969-70534991 ATCCTTATTCTGCTACTTGCTGG + Intronic
932486097 2:72085251-72085273 AACCATGTTCTTGTACTCCCCGG + Intergenic
933426985 2:82126205-82126227 AAACAAATGCTGGAACTGGCCGG + Intergenic
936912533 2:117607668-117607690 AACTACATTCTGGTTCTTGCAGG + Intergenic
941294524 2:163719718-163719740 ATGCATATTCTGGCACTGGTTGG - Intronic
944417723 2:199495630-199495652 AACCATAGACTGGTTCTGGCTGG + Intergenic
944566051 2:200992097-200992119 AACTTTATTTTGGTACTGGAAGG + Intronic
944927953 2:204484836-204484858 AAGAATAGTCTGGTAGTGGCTGG - Intergenic
946879169 2:224160288-224160310 AACCATATTCTTGGACTTGAAGG + Intergenic
947193603 2:227538593-227538615 AACAATATTCTCTTGCTGGCAGG + Intronic
1169154345 20:3316722-3316744 ACCCAGATTCTGCTCCTGGCTGG - Exonic
1170471889 20:16675992-16676014 ATCCATATTCTTTTAGTGGCAGG - Intergenic
1174264911 20:49324295-49324317 GACCAGATTCAGGCACTGGCTGG - Intergenic
1177005006 21:15661296-15661318 AACCATATTCTGGTATTATAAGG + Intergenic
1179342919 21:40529605-40529627 AATCATATTATGGTCCAGGCAGG - Intronic
1181447680 22:22990727-22990749 AGCCATATTATGGACCTGGCTGG + Intergenic
1181890140 22:26055357-26055379 AGCCATGTTCTGGTCTTGGCTGG + Intergenic
949805342 3:7949425-7949447 AAGCATGTACTGGTACTAGCAGG + Intergenic
954211759 3:49101705-49101727 AGGCTTATTCTGGTCCTGGCAGG - Exonic
959787410 3:110316974-110316996 AACCATATTCTGATATTAGTGGG - Intergenic
962399036 3:135041272-135041294 AACCATAATGTGGTACTCCCTGG + Intronic
970992833 4:22233013-22233035 AACTCTATTCTAGTTCTGGCAGG - Intergenic
971336634 4:25729210-25729232 AACCATGCACTGGTTCTGGCTGG + Intergenic
973553098 4:52054676-52054698 GACCATAGGCTGGTTCTGGCCGG - Intronic
973655527 4:53044111-53044133 CACCATCTTCTGTTATTGGCTGG - Intronic
975974094 4:80075146-80075168 GACCATAGACTGGTTCTGGCTGG - Intronic
976064888 4:81174792-81174814 AACCATATCTTTGTGCTGGCAGG - Exonic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
981342383 4:143636413-143636435 AATCATTTTCTTGTACTGGCTGG - Intronic
982285057 4:153725419-153725441 AACCATATTCTGGTACTGGCAGG - Intronic
982704513 4:158692598-158692620 AACCATATTCTTTTACTGAGAGG - Intronic
983833049 4:172354693-172354715 AAGCATATTCTGCTACTGGTGGG - Intronic
992973455 5:82086533-82086555 AGCCATATTCTCAAACTGGCTGG - Intronic
993194626 5:84724916-84724938 AAGCATATTCTGCTACTGCGTGG - Intergenic
993848103 5:92970883-92970905 AAAAATATTCTGGCACTAGCTGG + Intergenic
1010708563 6:79143754-79143776 GTCCATACTCTGGGACTGGCTGG - Intergenic
1013249683 6:108321724-108321746 AACCTTATCCTGGTACTGTGAGG + Intronic
1014671386 6:124308748-124308770 ACCCATTTTATGGTACTGGTTGG + Intronic
1015726091 6:136301048-136301070 TGCCATATTCTGTTACTGGAAGG - Intergenic
1017560423 6:155622024-155622046 AGCCATATTCTTTTATTGGCTGG - Intergenic
1019672356 7:2288044-2288066 TTCAATATTCAGGTACTGGCTGG + Intronic
1022220669 7:28310415-28310437 AACCAGATTCTAGTCCTGGCTGG + Intronic
1023301388 7:38775971-38775993 ACCCCTATTCTTGTGCTGGCAGG + Intronic
1025865331 7:65375527-65375549 AATCAGATGCTGGTACTGGGAGG + Intronic
1026354904 7:69549063-69549085 AACCATCTTCTGGAAATGGATGG + Intergenic
1033479633 7:141727065-141727087 AATCATATTTTGGAGCTGGCTGG - Intronic
1033733537 7:144200718-144200740 AAAAATATTCTGTTACTGGCCGG + Intergenic
1033749513 7:144350255-144350277 AAAAATATTCTGTTACTGGCCGG - Intergenic
1035988403 8:4460044-4460066 AACAATATTCTGTTATTGGCTGG - Intronic
1040249114 8:45570008-45570030 AACAATCTTCTGGTACTATCTGG + Intergenic
1040252686 8:45622656-45622678 AACAATCTTCTGGTACTATCTGG + Intergenic
1040259578 8:45724195-45724217 AACAATCTTCTCGTACTGTCTGG + Intergenic
1043584562 8:81753303-81753325 AACCATATGATGGTTTTGGCAGG + Intronic
1044790080 8:95838198-95838220 CACCAAATTCAGGTACTGGTTGG + Intergenic
1050135891 9:2463890-2463912 GACTAAATTCTGGTACTAGCAGG + Intergenic
1061936998 9:133863481-133863503 AACCATGTTCTGGCCTTGGCTGG - Intronic
1062714852 9:138004009-138004031 AACCATCCTCTGCTGCTGGCGGG + Intronic
1190410232 X:50129813-50129835 AGCCATAGACTGGTTCTGGCTGG - Intergenic
1192146388 X:68685837-68685859 AACCACATTCTCTGACTGGCTGG - Intronic
1195427173 X:104747517-104747539 AACCATATTCTTTTACTTCCAGG - Intronic