ID: 982291182

View in Genome Browser
Species Human (GRCh38)
Location 4:153784408-153784430
Sequence GAGCCACAAATGGGGCTGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982291182_982291192 2 Left 982291182 4:153784408-153784430 CCCGTCAGCCCCATTTGTGGCTC 0: 1
1: 0
2: 0
3: 12
4: 146
Right 982291192 4:153784433-153784455 CCTGAGGGGAAAAGTTGCTAAGG 0: 1
1: 0
2: 0
3: 14
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982291182 Original CRISPR GAGCCACAAATGGGGCTGAC GGG (reversed) Intronic
901120442 1:6887773-6887795 AAGCCAGACATGGGGCTGGCAGG - Intronic
901815900 1:11793517-11793539 GAGGCACAAATATGGCTTACTGG + Intronic
903138764 1:21326243-21326265 GGGCCACAAATGGGGAGGGCTGG + Intronic
909183901 1:72460841-72460863 GTGCTACAAATAGGGCTGCCAGG - Intergenic
913997165 1:143661000-143661022 AAGCCACCAACAGGGCTGACTGG + Intergenic
917655297 1:177119913-177119935 GAGGAAGAAATGGGGCAGACTGG + Intronic
921882280 1:220269248-220269270 TAGCCACAAATGTGGTTGGCTGG + Intronic
922900759 1:229134810-229134832 TAGCCACAGCTGGAGCTGACTGG - Intergenic
1065299030 10:24303964-24303986 GAACCAGAAATGATGCTGACAGG + Intronic
1067160270 10:43819559-43819581 GAGCCCTGAATGGGGCTGTCTGG + Intergenic
1067708083 10:48626081-48626103 GGGCCAAAAATGGGGTTGATGGG - Intronic
1071282114 10:84112383-84112405 GGGTTACAAATGGGGGTGACCGG + Intergenic
1071508019 10:86244602-86244624 GAGCCAGAGGTGGGGCTGACTGG - Intronic
1072665581 10:97390209-97390231 GAGACTCAGATAGGGCTGACAGG + Intronic
1073327220 10:102649958-102649980 GAGCCAGAACTGGAGCTGGCCGG + Intronic
1073511280 10:104044124-104044146 GAGCCCAGAATGGGGCTGACTGG + Intronic
1074138098 10:110644695-110644717 AAGCCACAAAGGGGGCTCTCGGG - Intronic
1078411378 11:11122591-11122613 GAGCCACCAATGGGCCAGACAGG - Intergenic
1079294799 11:19223397-19223419 GAGCTACAACTGAGGCTCACAGG - Intergenic
1080313792 11:30925549-30925571 GAGACTCAAATGGGTCTGATGGG - Intronic
1084153443 11:67301826-67301848 GAGCCCCTCATGGGGCTGGCTGG + Intronic
1084658121 11:70531280-70531302 GAGGCACTCATGGGGCTGGCAGG - Intronic
1085029695 11:73263557-73263579 AAGCCACAATGGGGGCTGAGAGG + Intergenic
1086107202 11:83158229-83158251 CACCCCAAAATGGGGCTGACGGG - Intronic
1091403273 12:193678-193700 GAGCCCAAAATGGGGCTCAATGG + Intronic
1097363143 12:58680187-58680209 TGGCCACAACTTGGGCTGACAGG + Intronic
1097386311 12:58953522-58953544 GAACCAGAAATGAGGCTCACTGG + Intergenic
1097951375 12:65432627-65432649 AAGCTACAAATGGGGATGGCGGG - Intronic
1098803564 12:74992716-74992738 GATTCACAGATGGGGTTGACTGG + Intergenic
1106184579 13:27397938-27397960 GAGCCAGAAAGGGCGATGACAGG + Intergenic
1113861308 13:113489546-113489568 GAGCCACAAAGGAGACTGAGAGG - Intronic
1114277496 14:21160316-21160338 GAGCCTCAATTGGGGCTGGATGG + Intergenic
1116460661 14:45169511-45169533 TAGCCACACAGGAGGCTGACAGG - Intronic
1117209580 14:53481583-53481605 GAGCCACAGCTGGAGCTGAGTGG + Intergenic
1119062699 14:71492377-71492399 GAGCCAGAAGTGGGGTTTACAGG + Intronic
1119891437 14:78185459-78185481 GAGTAAGAAATGGGGCTGAAAGG + Intergenic
1120038900 14:79729886-79729908 GAGGCACTAATTGGGCTGACTGG + Intronic
1121047900 14:90801354-90801376 GAGTCAGAAATGGGTCTCACTGG - Intronic
1121078134 14:91086024-91086046 ATGCCACCACTGGGGCTGACAGG - Intronic
1122842439 14:104473061-104473083 GAGCCACAGAGGGGGCGGAAGGG - Intergenic
1124368073 15:29088055-29088077 GAGCCAGAGAGGGGGCTGAGAGG - Intronic
1126518873 15:49566013-49566035 GAGCCCCAAATGAGTCTTACAGG - Intronic
1127388219 15:58484638-58484660 GAGCCCCACCTGGAGCTGACTGG - Intronic
1128753085 15:70162834-70162856 CAGCCACATGTGGAGCTGACAGG + Intergenic
1131200826 15:90394447-90394469 CAGCCACATAGGTGGCTGACAGG - Intronic
1131348433 15:91673077-91673099 GAGCCTTTAATGGGGCAGACTGG - Intergenic
1132761107 16:1509053-1509075 GAGCCACTGATGGGGCTGGGTGG + Intronic
1132868858 16:2106718-2106740 CAGGCAGAAGTGGGGCTGACAGG - Intronic
1134522728 16:14925941-14925963 CAGGCAGAAGTGGGGCTGACAGG + Intronic
1134549901 16:15134115-15134137 CAGGCAGAAGTGGGGCTGACAGG - Intronic
1134710398 16:16324592-16324614 CAGGCAGAAGTGGGGCTGACAGG + Intergenic
1134718569 16:16368880-16368902 CAGGCAGAAGTGGGGCTGACAGG + Intergenic
1134949206 16:18344053-18344075 CAGGCAGAAGTGGGGCTGACAGG - Intergenic
1134956183 16:18383279-18383301 CAGGCAGAAGTGGGGCTGACAGG - Intergenic
1135912907 16:26577844-26577866 GTGCCACATCTGGGGCTTACCGG + Intergenic
1141990725 16:87607983-87608005 GAGAAACAAATGTGGCTGAAGGG + Intronic
1143260783 17:5596842-5596864 GAGCCAGAACCGGGGCTGAGTGG + Intronic
1143334677 17:6163307-6163329 GAGCCACACATAGGATTGACTGG + Intergenic
1145296661 17:21598376-21598398 GAGGGGGAAATGGGGCTGACAGG - Intergenic
1145786069 17:27594674-27594696 GGGCCACACATGGTGCTGAGAGG + Intronic
1146962284 17:36992837-36992859 GTGAAACAAATGGGGCTGCCAGG + Intronic
1147204943 17:38830422-38830444 GAGCCACCACTGTGCCTGACAGG + Intergenic
1148547569 17:48529516-48529538 TAGCCACCAATGGGGCTTCCAGG - Exonic
1148702619 17:49598789-49598811 GAGCCACAAAAAAGGCAGACAGG + Intergenic
1151817253 17:76477426-76477448 AAGTCACCATTGGGGCTGACGGG - Intronic
1152237230 17:79144871-79144893 GGCCCACAAAAGGGGCAGACGGG + Intronic
1152589906 17:81206484-81206506 GAGGCTCACATGGGGCTGAGAGG - Intronic
1156595197 18:38540835-38540857 GAGCCACATATGCGACTGACAGG + Intergenic
1159053688 18:63444796-63444818 GAGCCATCACTGAGGCTGACAGG + Intergenic
1162106598 19:8373643-8373665 GAGCCACCGATGGGGCTGAAAGG - Intronic
1165087769 19:33363195-33363217 GCCCCACAAATGGGGATTACAGG - Intergenic
1166381941 19:42359240-42359262 GAGCCACAATGGGGACTTACGGG - Exonic
1167595444 19:50425303-50425325 CAGCCACAAATGAGGCTGTGTGG - Intronic
1168649820 19:58085885-58085907 GAGCCTCCAATGGGGCAGAACGG + Intronic
925112434 2:1347570-1347592 GAGCCAGACAGGGGCCTGACAGG - Intronic
925970490 2:9103460-9103482 AAGCCACACATGGGGCTGAGGGG + Intergenic
926050434 2:9740953-9740975 GAGCCTCAAAAGAGGCTGGCAGG + Intergenic
927435507 2:23063031-23063053 TAGGCAGAAATGGGGGTGACTGG - Intergenic
928393317 2:30925830-30925852 GGTCCACAAATGGGTCTGATGGG + Intronic
935117505 2:100149090-100149112 AAGACACAAATAGGGCCGACAGG + Intergenic
935427006 2:102930054-102930076 TAGCTACAAATAGGGCTGAGTGG - Intergenic
935634973 2:105243181-105243203 GAGCCAAATATGGGGCTGATGGG + Intergenic
937971284 2:127551324-127551346 AAGCCACAACTGGGGCTGGAGGG + Intronic
942408089 2:175676735-175676757 GCCCCAGAAATGGGCCTGACTGG + Intergenic
945977185 2:216280129-216280151 GAGCCTCATATGGGACAGACAGG - Intronic
948880523 2:240855018-240855040 GAGCCACATGTGGGGGTGATTGG + Intergenic
1170590225 20:17765901-17765923 AAGGAACAAATGGGGCTGATGGG - Intergenic
1173860486 20:46280060-46280082 GAGTCACACCTGGGGCTGTCTGG + Intronic
1174383469 20:50172309-50172331 GAGCCACAGTGGGGGCTGCCTGG + Intergenic
1176418368 21:6493974-6493996 GAGCTAGAAATGGAGCTGGCTGG - Intergenic
1179693861 21:43102296-43102318 GAGCTAGAAATGGAGCTGGCTGG - Intronic
1180880270 22:19198487-19198509 GAGCCAGAGATGGGGCAGAGAGG - Intronic
1182935404 22:34217417-34217439 GAGCCATGGGTGGGGCTGACAGG - Intergenic
1183190392 22:36318690-36318712 TACCCACCAATGGGGCTGAGAGG + Intronic
1183953703 22:41367159-41367181 GAGCCATAACTGGGGCTGCCAGG - Intergenic
1185276147 22:49950927-49950949 GACCCCCAAATGTGGCTGAGTGG - Intergenic
1185294596 22:50046897-50046919 AGGCCAAAGATGGGGCTGACTGG - Intronic
950196331 3:11011574-11011596 GAGCCAGAAATGGGACTCTCTGG - Intronic
950911947 3:16604750-16604772 GCGCCAGAAATGAGGCTGGCGGG + Exonic
952830655 3:37562086-37562108 GAGCCACGAATGGGGCACTCGGG + Intronic
953374415 3:42416854-42416876 GAGCCACAAATCGGGGAGCCAGG + Intergenic
953536787 3:43782846-43782868 GAACCACATCTGGGGCTGTCTGG + Intergenic
954447383 3:50553984-50554006 GAGCAAGAAATGGGGGTGAGGGG - Intergenic
959501447 3:107110549-107110571 GAGCAATAAATGGGGAAGACTGG + Intergenic
966918788 3:184599213-184599235 CAGCCACACATGGAGATGACAGG + Intronic
970101027 4:12523285-12523307 GAGCCACAAATGGTTTGGACTGG - Intergenic
970615883 4:17767716-17767738 GAGACCCAAAGGGGGCTGGCGGG - Intronic
973368389 4:49226109-49226131 GAAACACAAATGGGACTTACAGG + Intergenic
973392658 4:49569316-49569338 GAAACACAAATGGGACTTACAGG - Intergenic
975254558 4:72217142-72217164 GAGGCACAAGTGGTGGTGACAGG - Intergenic
982291182 4:153784408-153784430 GAGCCACAAATGGGGCTGACGGG - Intronic
1202765496 4_GL000008v2_random:145621-145643 GAAACACAAATGGGACTTACAGG + Intergenic
986028359 5:3871993-3872015 TCGACACAAATGGGGCTGAAGGG - Intergenic
986204910 5:5614253-5614275 CAGCAACAAATGGGCCTCACAGG + Intergenic
987924620 5:24324237-24324259 AAGCCCCAAATGGGTCTCACAGG - Intergenic
992689632 5:79230071-79230093 GAGCCACAGATGGAACTGAATGG - Intronic
995241545 5:109890551-109890573 GAGACACAAATGGGGCCTTCAGG - Intergenic
997475774 5:134141618-134141640 CAGCCATAACTGGGGCTGCCGGG + Intronic
998719169 5:144923974-144923996 TAGCCACAAATGGGACTGCTGGG - Intergenic
1000621337 5:163489691-163489713 GTTCCATGAATGGGGCTGACTGG + Intronic
1012135497 6:95551357-95551379 GAGCCACAGATGGGACAAACTGG + Intergenic
1015527047 6:134183955-134183977 GAGACACAAATTGTGCTGCCTGG - Intronic
1016324146 6:142880413-142880435 GAGCCTCAAGTGGGACTGACAGG + Intronic
1016357160 6:143230890-143230912 GAGCAACAAATGGTTCTGAAAGG - Intronic
1018053501 6:160031900-160031922 GAGCCATGAAGGGGGCTGATGGG - Intronic
1018910770 6:168100030-168100052 GAGACACAAATGATGCTGAGTGG + Intergenic
1019368159 7:645855-645877 GAGCCCCAGAGGGGTCTGACTGG - Intronic
1019655593 7:2193189-2193211 GAGCCCAAACTGAGGCTGACAGG + Intronic
1022819310 7:33943519-33943541 CAGACACACATGGGCCTGACAGG - Intronic
1023838180 7:44080544-44080566 GAACCACAGAAGGGGCTGAGGGG - Intronic
1025826744 7:65016852-65016874 GAGGAACAAATGGGGAAGACAGG + Intergenic
1025914292 7:65853301-65853323 GAGGAACAAATGGGGAAGACAGG + Intergenic
1026674830 7:72419716-72419738 GAGCAACACAAGTGGCTGACCGG + Intronic
1033288206 7:140060670-140060692 GAGCCACTCATGGGGGTAACTGG - Intronic
1037616514 8:20523994-20524016 GACCCTTAAATGGAGCTGACGGG - Intergenic
1039042991 8:33425618-33425640 GAGCCGCAAAAGGGGCTCAATGG + Intronic
1039842624 8:41304661-41304683 GAGCCATAAGGGGGGCTGATGGG - Intronic
1040323425 8:46329610-46329632 GGGCCACAAACGGGGCTGTGTGG - Intergenic
1043143237 8:76617629-76617651 GAGCCACAAGTATGGCTGAATGG + Intergenic
1043967064 8:86490580-86490602 AAGCCAAAAATGGGTCTGACTGG - Intronic
1048839172 8:138549995-138550017 CTCCCACACATGGGGCTGACAGG - Intergenic
1049602604 8:143514897-143514919 TAGCCGCACATGGGCCTGACAGG - Intronic
1051745326 9:20290046-20290068 GAGCCACAACAGTGGCTTACAGG + Intergenic
1053039982 9:34862358-34862380 GAGCCACAAATCGTGCTGCCTGG - Intergenic
1055797020 9:79985761-79985783 GTGCCACAAATACGGCTGCCAGG - Intergenic
1057664088 9:97030232-97030254 GAACCACACATAGGGCTGAGTGG + Exonic
1060075051 9:120583306-120583328 GAAACCCAAATGGGGATGACAGG - Intergenic
1062277516 9:135737787-135737809 GAGCTAGAAATGGGGGTGCCGGG - Intronic
1186460980 X:9748530-9748552 GAGCCAAGGATGGGGCTGCCTGG + Intronic
1186829538 X:13377024-13377046 GAGCCAAAAATGAAGCTGCCTGG + Intergenic
1187251059 X:17598212-17598234 GAGCCACATCTGGGACTGCCAGG - Intronic
1190936283 X:55001422-55001444 GAGCCAGAGTTGGGGGTGACGGG - Intronic
1193585020 X:83310967-83310989 GAGCCACAAGTTGTGCTGTCTGG - Intergenic
1194752999 X:97705336-97705358 CAGCCAAAAATTGGCCTGACAGG - Intergenic
1196614707 X:117754765-117754787 CAGCCACACATGTGGTTGACTGG + Intergenic
1197760985 X:130028137-130028159 GAGTGACAAATGGGGCAGTCAGG + Intronic
1200056951 X:153466556-153466578 CGGCCCTAAATGGGGCTGACAGG + Intronic
1202357255 Y:24064449-24064471 GATCCACAAATGCTGCTGCCTGG - Intergenic
1202513522 Y:25605665-25605687 GATCCACAAATGCTGCTGCCTGG + Intergenic