ID: 982293578

View in Genome Browser
Species Human (GRCh38)
Location 4:153804323-153804345
Sequence CTGTGTCATCCCAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982293571_982293578 16 Left 982293571 4:153804284-153804306 CCAGTATCAAGATGGTGGCATCT No data
Right 982293578 4:153804323-153804345 CTGTGTCATCCCAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982293578 Original CRISPR CTGTGTCATCCCAAGGTGGA GGG Intergenic
No off target data available for this crispr