ID: 982297874

View in Genome Browser
Species Human (GRCh38)
Location 4:153848546-153848568
Sequence CAGTGGAAGAAGGAGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982297874_982297878 -9 Left 982297874 4:153848546-153848568 CCCTCCAGCTCCTTCTTCCACTG No data
Right 982297878 4:153848560-153848582 CTTCCACTGCTGTAGTGATTTGG No data
982297874_982297880 26 Left 982297874 4:153848546-153848568 CCCTCCAGCTCCTTCTTCCACTG No data
Right 982297880 4:153848595-153848617 TGTGAAGCATCTGTCAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982297874 Original CRISPR CAGTGGAAGAAGGAGCTGGA GGG (reversed) Intergenic
No off target data available for this crispr