ID: 982307277

View in Genome Browser
Species Human (GRCh38)
Location 4:153945828-153945850
Sequence GACTCTGATGTGTCTCAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982307275_982307277 -7 Left 982307275 4:153945812-153945834 CCTAACTTCCGAGTCTGACTCTG No data
Right 982307277 4:153945828-153945850 GACTCTGATGTGTCTCAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982307277 Original CRISPR GACTCTGATGTGTCTCAATG TGG Intergenic
No off target data available for this crispr