ID: 982307523

View in Genome Browser
Species Human (GRCh38)
Location 4:153948450-153948472
Sequence TAAACTAGGATTGCAGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982307523_982307524 -10 Left 982307523 4:153948450-153948472 CCTGGAGCTGCAATCCTAGTTTA No data
Right 982307524 4:153948463-153948485 TCCTAGTTTAATCCCAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982307523 Original CRISPR TAAACTAGGATTGCAGCTCC AGG (reversed) Intergenic
No off target data available for this crispr