ID: 982315015

View in Genome Browser
Species Human (GRCh38)
Location 4:154023519-154023541
Sequence TGTGCGTTATGATAGCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982315015_982315020 8 Left 982315015 4:154023519-154023541 CCCAGCAGCTATCATAACGCACA No data
Right 982315020 4:154023550-154023572 ACTCAGCAATGATGCGGAATGGG No data
982315015_982315017 2 Left 982315015 4:154023519-154023541 CCCAGCAGCTATCATAACGCACA No data
Right 982315017 4:154023544-154023566 GCAGCCACTCAGCAATGATGCGG No data
982315015_982315022 13 Left 982315015 4:154023519-154023541 CCCAGCAGCTATCATAACGCACA No data
Right 982315022 4:154023555-154023577 GCAATGATGCGGAATGGGGAAGG No data
982315015_982315019 7 Left 982315015 4:154023519-154023541 CCCAGCAGCTATCATAACGCACA No data
Right 982315019 4:154023549-154023571 CACTCAGCAATGATGCGGAATGG No data
982315015_982315021 9 Left 982315015 4:154023519-154023541 CCCAGCAGCTATCATAACGCACA No data
Right 982315021 4:154023551-154023573 CTCAGCAATGATGCGGAATGGGG No data
982315015_982315023 23 Left 982315015 4:154023519-154023541 CCCAGCAGCTATCATAACGCACA No data
Right 982315023 4:154023565-154023587 GGAATGGGGAAGGAAAGTGCTGG No data
982315015_982315024 24 Left 982315015 4:154023519-154023541 CCCAGCAGCTATCATAACGCACA No data
Right 982315024 4:154023566-154023588 GAATGGGGAAGGAAAGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982315015 Original CRISPR TGTGCGTTATGATAGCTGCT GGG (reversed) Intergenic
No off target data available for this crispr