ID: 982315016

View in Genome Browser
Species Human (GRCh38)
Location 4:154023520-154023542
Sequence TTGTGCGTTATGATAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982315016_982315024 23 Left 982315016 4:154023520-154023542 CCAGCAGCTATCATAACGCACAA No data
Right 982315024 4:154023566-154023588 GAATGGGGAAGGAAAGTGCTGGG No data
982315016_982315022 12 Left 982315016 4:154023520-154023542 CCAGCAGCTATCATAACGCACAA No data
Right 982315022 4:154023555-154023577 GCAATGATGCGGAATGGGGAAGG No data
982315016_982315019 6 Left 982315016 4:154023520-154023542 CCAGCAGCTATCATAACGCACAA No data
Right 982315019 4:154023549-154023571 CACTCAGCAATGATGCGGAATGG No data
982315016_982315021 8 Left 982315016 4:154023520-154023542 CCAGCAGCTATCATAACGCACAA No data
Right 982315021 4:154023551-154023573 CTCAGCAATGATGCGGAATGGGG No data
982315016_982315023 22 Left 982315016 4:154023520-154023542 CCAGCAGCTATCATAACGCACAA No data
Right 982315023 4:154023565-154023587 GGAATGGGGAAGGAAAGTGCTGG No data
982315016_982315020 7 Left 982315016 4:154023520-154023542 CCAGCAGCTATCATAACGCACAA No data
Right 982315020 4:154023550-154023572 ACTCAGCAATGATGCGGAATGGG No data
982315016_982315017 1 Left 982315016 4:154023520-154023542 CCAGCAGCTATCATAACGCACAA No data
Right 982315017 4:154023544-154023566 GCAGCCACTCAGCAATGATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982315016 Original CRISPR TTGTGCGTTATGATAGCTGC TGG (reversed) Intergenic
No off target data available for this crispr