ID: 982315021

View in Genome Browser
Species Human (GRCh38)
Location 4:154023551-154023573
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982315016_982315021 8 Left 982315016 4:154023520-154023542 CCAGCAGCTATCATAACGCACAA No data
Right 982315021 4:154023551-154023573 CTCAGCAATGATGCGGAATGGGG No data
982315015_982315021 9 Left 982315015 4:154023519-154023541 CCCAGCAGCTATCATAACGCACA No data
Right 982315021 4:154023551-154023573 CTCAGCAATGATGCGGAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type