ID: 982317733

View in Genome Browser
Species Human (GRCh38)
Location 4:154048305-154048327
Sequence CAGCCAAAGGATACAGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982317727_982317733 22 Left 982317727 4:154048260-154048282 CCCAGAGGGGCTGAGCATGGGGT No data
Right 982317733 4:154048305-154048327 CAGCCAAAGGATACAGGAGGAGG No data
982317728_982317733 21 Left 982317728 4:154048261-154048283 CCAGAGGGGCTGAGCATGGGGTG No data
Right 982317733 4:154048305-154048327 CAGCCAAAGGATACAGGAGGAGG No data
982317723_982317733 30 Left 982317723 4:154048252-154048274 CCTAGAGACCCAGAGGGGCTGAG No data
Right 982317733 4:154048305-154048327 CAGCCAAAGGATACAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982317733 Original CRISPR CAGCCAAAGGATACAGGAGG AGG Intergenic
No off target data available for this crispr