ID: 982321731

View in Genome Browser
Species Human (GRCh38)
Location 4:154083917-154083939
Sequence TTGAAACAGCATGAGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982321731_982321733 -8 Left 982321731 4:154083917-154083939 CCATTCTCCTCATGCTGTTTCAA No data
Right 982321733 4:154083932-154083954 TGTTTCAAAGCTCTGATGAATGG No data
982321731_982321735 18 Left 982321731 4:154083917-154083939 CCATTCTCCTCATGCTGTTTCAA No data
Right 982321735 4:154083958-154083980 TCCTGTCCTGGCTCTCCTTCAGG No data
982321731_982321734 6 Left 982321731 4:154083917-154083939 CCATTCTCCTCATGCTGTTTCAA No data
Right 982321734 4:154083946-154083968 GATGAATGGAGTTCCTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982321731 Original CRISPR TTGAAACAGCATGAGGAGAA TGG (reversed) Intergenic
No off target data available for this crispr