ID: 982323114

View in Genome Browser
Species Human (GRCh38)
Location 4:154100988-154101010
Sequence GCATTCTGAAAAAACATCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982323114_982323119 19 Left 982323114 4:154100988-154101010 CCAGGGATGTTTTTTCAGAATGC No data
Right 982323119 4:154101030-154101052 CCCTTTATGGGTTCCTCCTCAGG No data
982323114_982323116 6 Left 982323114 4:154100988-154101010 CCAGGGATGTTTTTTCAGAATGC No data
Right 982323116 4:154101017-154101039 AGGCTCACAAAAGCCCTTTATGG No data
982323114_982323117 7 Left 982323114 4:154100988-154101010 CCAGGGATGTTTTTTCAGAATGC No data
Right 982323117 4:154101018-154101040 GGCTCACAAAAGCCCTTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982323114 Original CRISPR GCATTCTGAAAAAACATCCC TGG (reversed) Intergenic
No off target data available for this crispr