ID: 982323116

View in Genome Browser
Species Human (GRCh38)
Location 4:154101017-154101039
Sequence AGGCTCACAAAAGCCCTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982323114_982323116 6 Left 982323114 4:154100988-154101010 CCAGGGATGTTTTTTCAGAATGC No data
Right 982323116 4:154101017-154101039 AGGCTCACAAAAGCCCTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982323116 Original CRISPR AGGCTCACAAAAGCCCTTTA TGG Intergenic
No off target data available for this crispr