ID: 982323117

View in Genome Browser
Species Human (GRCh38)
Location 4:154101018-154101040
Sequence GGCTCACAAAAGCCCTTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982323114_982323117 7 Left 982323114 4:154100988-154101010 CCAGGGATGTTTTTTCAGAATGC No data
Right 982323117 4:154101018-154101040 GGCTCACAAAAGCCCTTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982323117 Original CRISPR GGCTCACAAAAGCCCTTTAT GGG Intergenic
No off target data available for this crispr