ID: 982323119

View in Genome Browser
Species Human (GRCh38)
Location 4:154101030-154101052
Sequence CCCTTTATGGGTTCCTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982323114_982323119 19 Left 982323114 4:154100988-154101010 CCAGGGATGTTTTTTCAGAATGC No data
Right 982323119 4:154101030-154101052 CCCTTTATGGGTTCCTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982323119 Original CRISPR CCCTTTATGGGTTCCTCCTC AGG Intergenic
No off target data available for this crispr