ID: 982325306

View in Genome Browser
Species Human (GRCh38)
Location 4:154123784-154123806
Sequence TGGGTTCCAAAGAAACTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982325299_982325306 21 Left 982325299 4:154123740-154123762 CCTCTTAAGGTGCCTTAGGGGGT No data
Right 982325306 4:154123784-154123806 TGGGTTCCAAAGAAACTGCCAGG No data
982325300_982325306 9 Left 982325300 4:154123752-154123774 CCTTAGGGGGTGTCTGTTGCAAA No data
Right 982325306 4:154123784-154123806 TGGGTTCCAAAGAAACTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982325306 Original CRISPR TGGGTTCCAAAGAAACTGCC AGG Intergenic
No off target data available for this crispr