ID: 982326011

View in Genome Browser
Species Human (GRCh38)
Location 4:154128793-154128815
Sequence GGAAACCAGTGCTCCAGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982326009_982326011 6 Left 982326009 4:154128764-154128786 CCAGAGGATTCTGGTGCACACTG No data
Right 982326011 4:154128793-154128815 GGAAACCAGTGCTCCAGAGTAGG No data
982326008_982326011 9 Left 982326008 4:154128761-154128783 CCACCAGAGGATTCTGGTGCACA No data
Right 982326011 4:154128793-154128815 GGAAACCAGTGCTCCAGAGTAGG No data
982326007_982326011 10 Left 982326007 4:154128760-154128782 CCCACCAGAGGATTCTGGTGCAC No data
Right 982326011 4:154128793-154128815 GGAAACCAGTGCTCCAGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982326011 Original CRISPR GGAAACCAGTGCTCCAGAGT AGG Intergenic
No off target data available for this crispr