ID: 982331595

View in Genome Browser
Species Human (GRCh38)
Location 4:154187154-154187176
Sequence TGTGCCCAGTAACACCATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982331592_982331595 4 Left 982331592 4:154187127-154187149 CCAGCACATGAGAGCTGCAGTAT No data
Right 982331595 4:154187154-154187176 TGTGCCCAGTAACACCATGCAGG No data
982331591_982331595 20 Left 982331591 4:154187111-154187133 CCACAGACACTCAACGCCAGCAC No data
Right 982331595 4:154187154-154187176 TGTGCCCAGTAACACCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982331595 Original CRISPR TGTGCCCAGTAACACCATGC AGG Intergenic
No off target data available for this crispr