ID: 982337578

View in Genome Browser
Species Human (GRCh38)
Location 4:154257592-154257614
Sequence CTCTGTTGATGCAGTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 438}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982337578_982337592 22 Left 982337578 4:154257592-154257614 CCCCCAGGACTGCATCAACAGAG 0: 1
1: 0
2: 0
3: 15
4: 438
Right 982337592 4:154257637-154257659 GTGGGGCTGTAACCAAAGGAGGG 0: 1
1: 0
2: 0
3: 17
4: 154
982337578_982337591 21 Left 982337578 4:154257592-154257614 CCCCCAGGACTGCATCAACAGAG 0: 1
1: 0
2: 0
3: 15
4: 438
Right 982337591 4:154257636-154257658 TGTGGGGCTGTAACCAAAGGAGG 0: 1
1: 0
2: 0
3: 19
4: 200
982337578_982337584 -6 Left 982337578 4:154257592-154257614 CCCCCAGGACTGCATCAACAGAG 0: 1
1: 0
2: 0
3: 15
4: 438
Right 982337584 4:154257609-154257631 ACAGAGGGTCAGACCCTCAAAGG 0: 1
1: 0
2: 1
3: 13
4: 127
982337578_982337585 3 Left 982337578 4:154257592-154257614 CCCCCAGGACTGCATCAACAGAG 0: 1
1: 0
2: 0
3: 15
4: 438
Right 982337585 4:154257618-154257640 CAGACCCTCAAAGGAGTTTGTGG No data
982337578_982337590 18 Left 982337578 4:154257592-154257614 CCCCCAGGACTGCATCAACAGAG 0: 1
1: 0
2: 0
3: 15
4: 438
Right 982337590 4:154257633-154257655 GTTTGTGGGGCTGTAACCAAAGG 0: 1
1: 0
2: 1
3: 19
4: 270
982337578_982337586 4 Left 982337578 4:154257592-154257614 CCCCCAGGACTGCATCAACAGAG 0: 1
1: 0
2: 0
3: 15
4: 438
Right 982337586 4:154257619-154257641 AGACCCTCAAAGGAGTTTGTGGG 0: 1
1: 0
2: 1
3: 8
4: 152
982337578_982337587 5 Left 982337578 4:154257592-154257614 CCCCCAGGACTGCATCAACAGAG 0: 1
1: 0
2: 0
3: 15
4: 438
Right 982337587 4:154257620-154257642 GACCCTCAAAGGAGTTTGTGGGG 0: 1
1: 0
2: 0
3: 8
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982337578 Original CRISPR CTCTGTTGATGCAGTCCTGG GGG (reversed) Intronic
900214656 1:1475089-1475111 CTGAGTTGCTCCAGTCCTGGCGG + Intronic
900221865 1:1513438-1513460 CTGAGTTGCTCCAGTCCTGGCGG + Intronic
900284418 1:1892127-1892149 CTGTGCTGGTGCAGGCCTGGAGG - Intergenic
900880849 1:5380332-5380354 CTTTGTCCATCCAGTCCTGGGGG - Intergenic
902641283 1:17767951-17767973 GTCTGTGGGTTCAGTCCTGGGGG + Intronic
902819154 1:18933029-18933051 GTTTGTTGATTCTGTCCTGGGGG - Intronic
904378476 1:30096043-30096065 CTCAGTTCATGCAGTTCTGTGGG + Intergenic
905525250 1:38633340-38633362 CTCTTGTGAGGCAGGCCTGGTGG + Intergenic
905841015 1:41178203-41178225 CTCTTTTAGGGCAGTCCTGGTGG - Intronic
905896894 1:41553676-41553698 CTCTTGTAAGGCAGTCCTGGTGG + Intronic
906353468 1:45083020-45083042 CTCTGGTGCTACAGGCCTGGGGG + Intronic
906374780 1:45286514-45286536 CTCTTTTAGGGCAGTCCTGGTGG - Intronic
906585926 1:46977940-46977962 CTCTTGTAAGGCAGTCCTGGTGG - Intergenic
906659685 1:47573486-47573508 CTGTGTGGACGCCGTCCTGGGGG + Intergenic
908584422 1:65552892-65552914 CTCTTTTAAGGCAGGCCTGGTGG + Intronic
908821479 1:68091770-68091792 CTCTTGTAAGGCAGTCCTGGTGG + Intergenic
909415870 1:75404662-75404684 CTCTTGTAAGGCAGTCCTGGTGG - Intronic
910643966 1:89492932-89492954 CTCTTTTAGGGCAGTCCTGGTGG - Intergenic
911225083 1:95296410-95296432 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
911339099 1:96616035-96616057 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
911676732 1:100667155-100667177 CTCTTTTCAGGCAGGCCTGGTGG + Intergenic
912738819 1:112174712-112174734 CCCTGTTGACTCAGTGCTGGAGG + Intergenic
913720188 1:121585344-121585366 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
915814826 1:158954566-158954588 CTCTTTTAAGGCAGGCCTGGTGG - Intronic
917252325 1:173075899-173075921 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
917259914 1:173155687-173155709 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
917287720 1:173439105-173439127 TTCTGCAGATCCAGTCCTGGAGG + Intergenic
917401211 1:174652012-174652034 CTCTTTTAAGGCAGGCCTGGTGG + Intronic
917923658 1:179771274-179771296 CTCTGTGGGTGCAGAGCTGGTGG - Intronic
917965964 1:180178699-180178721 CGCTGGTGATGCAGTGCTGCAGG - Intronic
918366189 1:183810389-183810411 CTGTGGTCATGCAGTCCTTGTGG + Intronic
919048583 1:192484254-192484276 CTCTTTTGGGGCAGGCCTGGTGG - Intergenic
920638945 1:207732293-207732315 CTCTTTTAAGGCAGGCCTGGTGG - Intronic
921358109 1:214305509-214305531 GTCTGTGGCTGCAGTCCTTGGGG - Intronic
921455283 1:215364103-215364125 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
921484661 1:215701993-215702015 CTCTTGTAATGCAGGCCTGGTGG + Intronic
922354657 1:224764395-224764417 CATTGTTGATCCAGGCCTGGGGG - Intergenic
923962009 1:239096368-239096390 ATCTGCTGATGCAGTCCCTGGGG + Intergenic
924857815 1:247892497-247892519 CTCTTTTGGGGCAGGCCTGGTGG + Intergenic
1063425433 10:5946830-5946852 CTCTGTTGTTTCAGTTTTGGAGG - Intronic
1064905142 10:20338024-20338046 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
1065606839 10:27426976-27426998 CTAAGTACATGCAGTCCTGGTGG - Intergenic
1066001699 10:31110559-31110581 CTCTTTTAGTGCAGGCCTGGTGG + Intergenic
1066238953 10:33515027-33515049 CTCTTTTAGGGCAGTCCTGGTGG + Intergenic
1066818301 10:39450661-39450683 CTCTTTTAGTGCAGGCCTGGTGG + Intergenic
1067589223 10:47495135-47495157 CCCTGGTGATGCAGTCCAAGAGG + Intergenic
1067636348 10:48003226-48003248 CCCTGGTGATGCAGTCCAAGAGG + Intergenic
1067955489 10:50786624-50786646 CTCTTTTAGTGCAGGCCTGGTGG + Intronic
1068256406 10:54517025-54517047 CTCTTTTGGGGCAGGCCTGGTGG - Intronic
1068940485 10:62676387-62676409 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
1069817911 10:71210258-71210280 CCCTGATGCTGGAGTCCTGGAGG + Intergenic
1070132904 10:73667219-73667241 CCCTGGTGATGCAGTCCAAGAGG + Intergenic
1071608768 10:87016847-87016869 CCCTGGTGATGCAGTCCAAGAGG - Intergenic
1072485351 10:95849451-95849473 CTCTCTTGCTGGGGTCCTGGAGG - Intronic
1073571562 10:104584738-104584760 CTCTGTTGAGGGAGACGTGGTGG + Intergenic
1073587382 10:104724152-104724174 CTCTTTTAGGGCAGTCCTGGTGG + Intronic
1073614053 10:104974872-104974894 CTCTTTTAGGGCAGTCCTGGTGG + Intronic
1073647678 10:105322790-105322812 CTCTTTTAAAGCAGGCCTGGTGG + Intergenic
1074808927 10:117083212-117083234 CTCTTTTAGGGCAGTCCTGGTGG + Intronic
1075569456 10:123529289-123529311 CTGTGCTGCTGCAGTCCTTGAGG + Intergenic
1076756081 10:132572447-132572469 CTGTGCTGGTGCTGTCCTGGGGG + Intronic
1077253491 11:1571025-1571047 CTCTGGTGCTGCAGTGATGGGGG - Intronic
1078391512 11:10939026-10939048 CTGTGTTGGTTCAGTCCTGCTGG + Intergenic
1078788341 11:14519147-14519169 CTCTGTTCATGCAGTCTTACTGG + Intronic
1079174471 11:18126368-18126390 CTCTTTTAGGGCAGTCCTGGTGG + Intronic
1079582636 11:22085208-22085230 CTGTGTTCATGTTGTCCTGGTGG + Intergenic
1079752752 11:24219055-24219077 CTCTTTTAGGGCAGTCCTGGTGG - Intergenic
1080845068 11:36019816-36019838 CTCTGTGGATGGAGGACTGGAGG + Intronic
1080905314 11:36539208-36539230 CTCTGTGCATGCATCCCTGGTGG - Intronic
1080907478 11:36561134-36561156 CTCTGGTGATGCAGTCCAAATGG + Intronic
1080965422 11:37209279-37209301 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
1081118472 11:39234028-39234050 CTCTTGTGAGGCAGGCCTGGTGG - Intergenic
1081423759 11:42902754-42902776 CTCTGTTGATCAGGTCCTTGGGG - Intergenic
1081640484 11:44749979-44750001 CCCTGTTGAAGCAGGCATGGGGG + Intronic
1081732075 11:45378698-45378720 CTGTGCTGCTGCAGTCCAGGAGG - Intergenic
1082618934 11:55397441-55397463 CTCTGTTAGGGCAGACCTGGTGG + Intergenic
1082628447 11:55513181-55513203 CTCAGTGGATGAAGTCCTGCTGG + Intergenic
1082744147 11:56944319-56944341 CTCTTTTAGGGCAGTCCTGGTGG + Intergenic
1084007479 11:66331054-66331076 CTCTGCTGCTGCAGCCTTGGAGG + Intronic
1084477447 11:69396942-69396964 CTGGGTGGATCCAGTCCTGGTGG - Intergenic
1086433878 11:86762704-86762726 CTGTGTTGGTAGAGTCCTGGTGG + Intergenic
1086456692 11:86966256-86966278 CTCTTGTGAGGCAGGCCTGGTGG + Intergenic
1086475544 11:87169478-87169500 CTCTTGTGAGGCAGGCCTGGTGG + Intronic
1087072752 11:94098192-94098214 CTCTTGTAATGCAGGCCTGGTGG + Intronic
1088656846 11:112007772-112007794 CTCTTGTAAGGCAGTCCTGGTGG - Intronic
1090357632 11:126150542-126150564 CTCTGTTGGTGCAGTCCCCTTGG + Intergenic
1091073369 11:132590347-132590369 CTGTGTAGATGTGGTCCTGGGGG - Intronic
1092691094 12:11110618-11110640 CTCTTGTGAGGCAGGCCTGGTGG - Intronic
1093369164 12:18345358-18345380 CTCTGTTGAAACAGTCTGGGGGG - Intronic
1094162545 12:27406559-27406581 CTCTTGTAAGGCAGTCCTGGTGG - Intronic
1094222268 12:28007199-28007221 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
1094318475 12:29158531-29158553 CTATTTTGGTGCAGTCCTGCCGG + Intronic
1094406567 12:30122321-30122343 TTCTGATCATGCTGTCCTGGAGG - Intergenic
1095083487 12:38033376-38033398 CTCTTTTTGGGCAGTCCTGGTGG - Intergenic
1097619706 12:61924554-61924576 CTCTTGTGAGGCAGGCCTGGTGG - Intronic
1097898599 12:64851700-64851722 CTCTTGTGAGGCAGGCCTGGTGG + Intronic
1098642445 12:72855606-72855628 CTCTGTTAGGGCAGGCCTGGTGG + Intergenic
1099357890 12:81661012-81661034 CTCTTTTAGTGCAGGCCTGGTGG - Intronic
1099730200 12:86490388-86490410 CTCTTTTAGGGCAGTCCTGGTGG - Intronic
1100768532 12:97896469-97896491 CTCTTGTAAGGCAGTCCTGGTGG + Intergenic
1101190680 12:102329260-102329282 CTCTGTAGAGGCAGTTCTAGTGG - Intergenic
1102302755 12:111782935-111782957 CTCCTTTCATGAAGTCCTGGTGG - Intronic
1102372699 12:112395528-112395550 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
1104846811 12:131851095-131851117 CTCTGGTCATGTTGTCCTGGAGG - Exonic
1105829061 13:24148260-24148282 CTCTGGTGATGAAGTCCTCAGGG + Intronic
1105837313 13:24223080-24223102 GTCTGTGGCTGCAGCCCTGGTGG + Exonic
1106336359 13:28787061-28787083 CTCTGGTAAGGCAGGCCTGGTGG + Intergenic
1106640772 13:31582667-31582689 CTCTTGTAATGCAGGCCTGGTGG + Intergenic
1106646135 13:31636597-31636619 CTCTTGTAATGCAGGCCTGGCGG + Intergenic
1106714500 13:32373859-32373881 CTCTGTTAGTGCAGTACAGGAGG - Intronic
1107154794 13:37154134-37154156 CTCTGTTAGGGCAGGCCTGGTGG + Intergenic
1107162928 13:37252175-37252197 CTCTGTTAGGGCAGGCCTGGTGG - Intergenic
1107202727 13:37740867-37740889 TTCTGTTTATCCAGTCTTGGGGG - Intronic
1108237041 13:48418346-48418368 CTCTTGTAATGCAGGCCTGGTGG - Intronic
1108384052 13:49881677-49881699 CTCTTGTGAGGCAGGCCTGGTGG - Intergenic
1108715695 13:53075729-53075751 CTATGGTGATGAAATCCTGGGGG + Intergenic
1108892315 13:55276741-55276763 CTCTTGTAAGGCAGTCCTGGTGG + Intergenic
1109949428 13:69482031-69482053 CTCTTGTGAGGCAGGCCTGGTGG + Intergenic
1113936701 13:113998673-113998695 TTCTGATGATGCATTTCTGGCGG - Intronic
1114425591 14:22619804-22619826 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
1114691397 14:24585865-24585887 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
1116109988 14:40565618-40565640 CTCTGGTAAGGCAGTCCTGGTGG + Intergenic
1116113009 14:40610848-40610870 CTCTTGTAAGGCAGTCCTGGTGG + Intergenic
1117614289 14:57517719-57517741 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
1118066973 14:62203282-62203304 CTCTTTTGGGGCAGGCCTGGTGG + Intergenic
1120586149 14:86314177-86314199 CTCTTTTAGTGCAGGCCTGGTGG - Intergenic
1120598566 14:86472141-86472163 CTCTTTTAGTGCAGGCCTGGTGG + Intergenic
1120742745 14:88126381-88126403 CTCTTGTGAGGCAGGCCTGGTGG + Intergenic
1126264949 15:46742975-46742997 CTCTTGTGAGGCAGGCCTGGTGG - Intergenic
1127145622 15:56019990-56020012 GTCTGTTCATGCAGTTCAGGTGG - Intergenic
1128414610 15:67433542-67433564 ATCTTTTGAGGAAGTCCTGGGGG - Intronic
1130093831 15:80841484-80841506 CTCTGTTGGTACAGACATGGGGG + Intronic
1132567564 16:630449-630471 CTCTGGGAATGCAGTCCTGCCGG + Intronic
1136678665 16:31939503-31939525 CTCTTTTGGGGCAGGCCTGGTGG - Intergenic
1137046308 16:35665717-35665739 CTCTTGTGAGGCAGGCCTGGTGG - Intergenic
1137082105 16:36073749-36073771 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
1137575135 16:49594381-49594403 CTCTGTTGAGAGAGGCCTGGGGG - Intronic
1138540634 16:57685298-57685320 CTCTGTGGATGCCCTCCTGAAGG - Intronic
1138547442 16:57728315-57728337 CACTGCTGATGCAGAGCTGGTGG + Intronic
1138874950 16:60937886-60937908 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
1139665345 16:68451215-68451237 CTCTGCTGATGCCCACCTGGTGG - Intergenic
1142223359 16:88865859-88865881 GCCTGTTGCTGCACTCCTGGAGG + Exonic
1142304692 16:89278721-89278743 CTCTCGTGAGGCCGTCCTGGTGG + Intronic
1142441325 16:90099897-90099919 CTCACTTGATGCAGTCCAGCAGG - Intergenic
1142917196 17:3151552-3151574 CTCTTTTAGTGCAGGCCTGGTGG + Intergenic
1142920259 17:3178360-3178382 CTCTTTTAGTGCAGGCCTGGTGG - Intergenic
1142935138 17:3323534-3323556 CTCTTTTAGTGCAGGCCTGGTGG + Intergenic
1142937611 17:3348996-3349018 CTCTTTTAGTGCAGGCCTGGTGG - Intergenic
1143915913 17:10292731-10292753 CTCAGTTCATGCAGTCTGGGTGG + Intergenic
1146269674 17:31476757-31476779 CTCTGTGGCTGCAGCCCAGGAGG - Intronic
1152821781 17:82441237-82441259 CTCTGTGGATGCGCTGCTGGAGG + Exonic
1153441450 18:5123954-5123976 CTCTTGTGAGGCAGACCTGGCGG - Intergenic
1158398834 18:57102630-57102652 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG + Intronic
1159143646 18:64426227-64426249 CTCTTTTGAGACAGGCCTGGTGG - Intergenic
1159248149 18:65837024-65837046 CACTGTTGATGCATTCATAGAGG - Intronic
1164430064 19:28179408-28179430 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
1166751676 19:45166819-45166841 CGCTGATGGTGCAGCCCTGGAGG - Intronic
1167959466 19:53094822-53094844 TGCTGTTGATCCAGTCCTAGTGG + Intronic
1168170361 19:54583948-54583970 CTCTTTTAAGGCAGGCCTGGTGG + Intronic
926052409 2:9753560-9753582 CTTTGTTGGGACAGTCCTGGTGG + Intergenic
926491867 2:13533722-13533744 CTCTGTTGAGGCAGTCTAGTGGG - Intergenic
926747195 2:16168575-16168597 CTCTGGTGAGGCTGGCCTGGAGG + Intergenic
931385207 2:61792367-61792389 CACTGTAGATGCAGACCTGCAGG + Intergenic
931477816 2:62607186-62607208 CTCTTTTAGGGCAGTCCTGGTGG - Intergenic
932601035 2:73125709-73125731 TCCTTTTGATGCAATCCTGGTGG - Intronic
933533432 2:83539631-83539653 CACTGTGTATCCAGTCCTGGTGG - Intergenic
934557792 2:95296613-95296635 CCCTGCTGATGTAGCCCTGGTGG + Intergenic
937013518 2:118582820-118582842 CTCTGTATTTGCAGTCCTGGAGG - Intergenic
937670902 2:124536337-124536359 CACCGATGCTGCAGTCCTGGGGG - Intronic
937735212 2:125279683-125279705 CTCTGATGATACCTTCCTGGGGG - Intergenic
938079606 2:128362762-128362784 CGCTGGTAATGCAGCCCTGGGGG - Intergenic
938148756 2:128863166-128863188 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
940067057 2:149642053-149642075 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
941691768 2:168507461-168507483 CTCAGTTAATGCATTCTTGGTGG + Intronic
942123235 2:172799502-172799524 ACCTGTGGATGCTGTCCTGGTGG + Intronic
942179130 2:173363062-173363084 CTCTGTTGATGTACTCTTTGTGG + Intronic
942744287 2:179213945-179213967 CTCTTTTGGGGCAGGCCTGGTGG - Intronic
942953484 2:181748721-181748743 CTCTTGTAAGGCAGTCCTGGTGG + Intergenic
943130164 2:183843842-183843864 CTCTTTTAAAGCAGGCCTGGTGG - Intergenic
943408567 2:187518316-187518338 CTCTTTTAAGGCAGGCCTGGTGG + Intronic
944520820 2:200565238-200565260 CTCTTTTAGGGCAGTCCTGGTGG + Intronic
944630015 2:201614524-201614546 CTCTTCTAATGCAGGCCTGGTGG - Intronic
944842257 2:203635453-203635475 CTTTGATGATGCAATCCAGGTGG + Intergenic
945486684 2:210405413-210405435 CTCTTGTAATGCAGGCCTGGTGG + Intergenic
945788652 2:214276471-214276493 CTCTTTTAAGGCAGGCCTGGTGG + Intronic
946529195 2:220553220-220553242 ATCTGTTGATGGAGGCCTAGTGG - Intergenic
948931562 2:241135620-241135642 CACTGGTGATGCACTCTTGGGGG + Intronic
949049667 2:241890822-241890844 GACTGTTGGTGCTGTCCTGGGGG - Intergenic
1169025978 20:2371932-2371954 CTCCCTAGATGCAATCCTGGAGG - Intergenic
1170987490 20:21271921-21271943 CTCTGGTGCTCCAGTGCTGGGGG - Intergenic
1171075297 20:22116573-22116595 CTCTTTTAGGGCAGTCCTGGTGG - Intergenic
1171772304 20:29332424-29332446 CTCTTTTAGGGCAGTCCTGGTGG - Intergenic
1174925332 20:54753041-54753063 CTCTGGTAAGGCAGGCCTGGTGG + Intergenic
1175235492 20:57507689-57507711 TTCGGATGATGCAGCCCTGGCGG + Intronic
1175722931 20:61298254-61298276 CCCTGATGATGCAGAGCTGGTGG - Intronic
1176641888 21:9312701-9312723 CTCTTGTAAGGCAGTCCTGGTGG - Intergenic
1176891981 21:14329116-14329138 CTCTGGTAAGGCAGGCCTGGTGG - Intergenic
1178393769 21:32221445-32221467 CTCTGGTAAGGCAGGCCTGGTGG - Intergenic
1180350902 22:11802054-11802076 CTCTTGTAAGGCAGTCCTGGTGG - Intergenic
1182560562 22:31155991-31156013 CTTGGTGGATGCATTCCTGGTGG + Intergenic
1182796125 22:32992977-32992999 TTCTTTTTGTGCAGTCCTGGTGG + Intronic
1183860626 22:40667385-40667407 GTCTGTTGATGCTGTTCTTGAGG - Intergenic
1184668623 22:46001465-46001487 CTCTGAAGATGCAAGCCTGGTGG - Intergenic
949155211 3:818456-818478 CTCTGGTAAGGCAGGCCTGGTGG - Intergenic
950619498 3:14192953-14192975 CTCTTGTGAGGCAGGCCTGGTGG + Intronic
950885903 3:16362608-16362630 CTGTGTTGATACAATCCTGATGG - Intronic
950925117 3:16732631-16732653 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
951071015 3:18329459-18329481 CTCTTTTAGGGCAGTCCTGGTGG + Intronic
951197976 3:19845551-19845573 CTCTCGTAAGGCAGTCCTGGTGG + Intergenic
951361012 3:21724116-21724138 CTCTTTTAAGGCAGGCCTGGTGG - Intronic
951363340 3:21750861-21750883 CTCTGATGATGTAATTCTGGGGG - Intronic
951450160 3:22828285-22828307 CTCTGGTAAGGCAGGCCTGGTGG - Intergenic
951457315 3:22907176-22907198 ATCTGTTGATGCAGTGCTGCAGG - Intergenic
951470008 3:23045764-23045786 CTCTTGTGAGGCAGGCCTGGTGG - Intergenic
951906004 3:27708186-27708208 ATCTCTTGATGCAGTCATAGAGG - Intergenic
952413727 3:33071908-33071930 ATCTGTTGAGGCAGGCCTTGAGG + Intronic
952501673 3:33968857-33968879 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
952513827 3:34083888-34083910 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
953074266 3:39553166-39553188 CTCTTTTAAGGCAGACCTGGTGG - Intergenic
953081112 3:39619168-39619190 CTCTGGTAAGGCAGGCCTGGTGG + Intergenic
953130794 3:40135848-40135870 CTCTTTTGGGGCAGGCCTGGTGG - Intronic
953736017 3:45494615-45494637 CTCTGCTGATCCAGGCCTTGAGG + Intronic
954890730 3:53925925-53925947 CTCTTTTGGGGCAGGCCTGGTGG + Intergenic
955022912 3:55138150-55138172 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
956720759 3:72115458-72115480 CTTTGTTGTTGTAGCCCTGGTGG - Intergenic
957092389 3:75744465-75744487 CTCTGTCTCTGCAATCCTGGGGG - Intronic
957475034 3:80711390-80711412 CTCTTGTGAGGCAGGCCTGGTGG - Intergenic
958257258 3:91339573-91339595 CTCTTGTAAGGCAGTCCTGGTGG + Intergenic
958404090 3:93730205-93730227 CTCTTTTAGGGCAGTCCTGGTGG + Intergenic
958410070 3:93805564-93805586 CTCTTTTAGGGCAGTCCTGGTGG + Intergenic
959091614 3:101909622-101909644 CTCTTGTGAGGCAGGCCTGGTGG + Intergenic
959881580 3:111449376-111449398 CTCTTTTAAGGCAGGCCTGGTGG - Intronic
960017694 3:112911612-112911634 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
960502895 3:118458673-118458695 CTCTGGTAATGCAGGCCTGGTGG - Intergenic
962642164 3:137398998-137399020 CTCTTGTAATGCAGGCCTGGTGG + Intergenic
964532909 3:157687156-157687178 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
964688617 3:159425006-159425028 CTCTTTTAAGGCAGGCCTGGTGG - Intronic
965021644 3:163238764-163238786 CTCTGTTAGGGCAGGCCTGGTGG - Intergenic
966150573 3:176863249-176863271 CTCTTGTGAGGCAGGCCTGGTGG - Intergenic
968047678 3:195632974-195632996 ATCTTCTGATTCAGTCCTGGGGG + Intergenic
968055857 3:195691275-195691297 ATCTTCTGATTCAGTCCTGGGGG + Intergenic
968099747 3:195956712-195956734 ATCTTCTGATTCAGTCCTGGGGG - Intergenic
1202745005 3_GL000221v1_random:92317-92339 CTCTTGTAAGGCAGTCCTGGTGG + Intergenic
969616881 4:8258408-8258430 CTCTGCTGCTCCAGTCCTGGTGG + Intergenic
973124724 4:46569070-46569092 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
974238179 4:59208417-59208439 CTCTTTTAGTGCAGGCCTGGTGG - Intergenic
974253646 4:59421601-59421623 CTCTTTTAGTGCAGGCCTGGTGG - Intergenic
974840952 4:67299156-67299178 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
974946418 4:68534619-68534641 CTCTGGTAAGGCAGGCCTGGTGG + Intergenic
974954442 4:68620724-68620746 CTCTTTTAAGGCAGTTCTGGTGG - Intronic
974962751 4:68724309-68724331 CGATGTTGATGAAGTCGTGGAGG + Intergenic
975232349 4:71949519-71949541 CTCTTGTAAGGCAGTCCTGGTGG - Intergenic
976769533 4:88635964-88635986 CTCTTGTAAGGCAGTCCTGGTGG - Intronic
976895419 4:90104187-90104209 CTCTGGTGATGTAATTCTGGTGG + Intergenic
976899575 4:90157050-90157072 CTCTTTTAGGGCAGTCCTGGTGG + Intronic
977425748 4:96864832-96864854 CTCTTGTAATGCAGGCCTGGTGG - Intergenic
977524125 4:98124353-98124375 CTCTGATAAGGCAGGCCTGGTGG + Intronic
978154792 4:105476425-105476447 CTCTGTTGATGAATCTCTGGTGG - Intergenic
978313463 4:107411227-107411249 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
980231349 4:130050377-130050399 CTCTTTTAGGGCAGTCCTGGTGG + Intergenic
981772076 4:148322055-148322077 CTCTTTTAAGGCAGGCCTGGTGG + Intronic
981789442 4:148520082-148520104 CTCTGGTAAGGCAGGCCTGGTGG + Intergenic
982337578 4:154257592-154257614 CTCTGTTGATGCAGTCCTGGGGG - Intronic
982648779 4:158059529-158059551 CTCTGCTGATGAAGGCATGGAGG + Intergenic
982692146 4:158560806-158560828 ATCTGCTGAGGAAGTCCTGGAGG - Intronic
983510824 4:168607957-168607979 CTCTGTTCCTGCAGTCCAAGGGG + Intronic
983978578 4:173967069-173967091 CTCTTGTAATGCAGGCCTGGTGG + Intergenic
986358735 5:6954079-6954101 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
986530624 5:8732806-8732828 CTCTTTTAGTGCAGTCCTGGTGG - Intergenic
987273470 5:16337238-16337260 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
987279554 5:16399131-16399153 CTCTTGTGAGGCAGACCTGGTGG + Intergenic
987555192 5:19437334-19437356 CTCAGAAGATGGAGTCCTGGTGG + Intergenic
988375224 5:30427551-30427573 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
989442736 5:41492111-41492133 CTCTTTTAGGGCAGTCCTGGTGG + Intronic
989516991 5:42355135-42355157 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
989946164 5:50232056-50232078 CTCTTTTAGGGCAGTCCTGGTGG - Intergenic
989977106 5:50600288-50600310 CTCTTTTGCGGCAGGCCTGGTGG + Intergenic
990704390 5:58511778-58511800 CTTTGTTGATGGATACCTGGAGG - Intergenic
990981060 5:61602785-61602807 CACTCTTAAAGCAGTCCTGGTGG + Intergenic
991571732 5:68061631-68061653 CTCTTGTAATGCAGGCCTGGTGG - Intergenic
992287871 5:75254164-75254186 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
993809290 5:92455942-92455964 CACTCTTGAAACAGTCCTGGTGG + Intergenic
994298997 5:98123360-98123382 CTCTTGTAATGCAGGCCTGGTGG - Intergenic
994476433 5:100276845-100276867 GTCTGTTGAAGTAGTGCTGGTGG - Intergenic
994642163 5:102423090-102423112 CTCTTGTAAGGCAGTCCTGGTGG - Intronic
995401338 5:111745301-111745323 ATGTGTTGCTACAGTCCTGGAGG + Intronic
995692837 5:114846354-114846376 CTCTTGTAATGCAGGCCTGGTGG - Intergenic
995699533 5:114918839-114918861 CTCTTTTGGGGCAGGCCTGGTGG + Intergenic
996114331 5:119601275-119601297 CTCTTTTAGGGCAGTCCTGGTGG - Intronic
996648318 5:125842973-125842995 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
996936990 5:128960884-128960906 CTCTTATAAGGCAGTCCTGGTGG + Intronic
996956076 5:129185251-129185273 CTCTTTTAGTGCAGGCCTGGTGG + Intergenic
997186957 5:131891892-131891914 CTCTTTTAGGGCAGTCCTGGTGG + Intronic
997216847 5:132118671-132118693 CTCTGGTAAGGCAGGCCTGGTGG - Intergenic
997844757 5:137276404-137276426 CTCTGTTCAGGCAGCCCAGGGGG - Intronic
998257670 5:140600960-140600982 ATCTGTTGGTGAAGTCCTAGTGG - Intergenic
998626679 5:143854023-143854045 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
999270359 5:150293309-150293331 CACTGTGCATGCGGTCCTGGGGG + Intergenic
1000582029 5:163046819-163046841 CTCTGGTAAGGCAGGCCTGGTGG + Intergenic
1000798167 5:165691577-165691599 CTCTTATAATGCAGGCCTGGTGG + Intergenic
1002216403 5:177637730-177637752 CTCTGGTAAGGCAGGCCTGGTGG + Intergenic
1002808325 6:601158-601180 CTTTGTTGATGCCTTCCTGGTGG - Intronic
1005208328 6:23430941-23430963 CTCTTGTAAGGCAGTCCTGGTGG + Intergenic
1007073514 6:39052849-39052871 CTCTGTTAATGCAGGACTGTGGG - Intronic
1007846145 6:44758659-44758681 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
1007974229 6:46084450-46084472 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
1008124599 6:47654263-47654285 CTCTGGTGATGCTGTACTGATGG - Intergenic
1008829227 6:55737486-55737508 CTCTTGTAATGCAGGCCTGGTGG - Intergenic
1008873953 6:56305911-56305933 CTCTTTTAGTGCAGGCCTGGTGG + Intronic
1009512507 6:64570257-64570279 CTCTGGTAAGGCAGGCCTGGGGG - Intronic
1009945155 6:70334803-70334825 CTCTTTTTAGGCAGGCCTGGTGG + Intergenic
1010093196 6:72008288-72008310 CTCTTTTAAGGCAGGCCTGGTGG - Intronic
1011241753 6:85278945-85278967 CTCTGTTGGTGCAGCCCTCTGGG + Intergenic
1011956852 6:93033969-93033991 CTCTTTTAGGGCAGTCCTGGTGG - Intergenic
1012585080 6:100912297-100912319 CTCTTGTAAGGCAGTCCTGGTGG + Intergenic
1012933422 6:105340357-105340379 CTCTTTTAAGGCAGGCCTGGTGG - Intronic
1013633836 6:112010075-112010097 CTTTGTTATAGCAGTCCTGGTGG + Intergenic
1014560430 6:122883484-122883506 CTCTTTTAAGGCAGACCTGGTGG + Intergenic
1014569235 6:122988163-122988185 CTCTTGTAATGCAGGCCTGGGGG - Intergenic
1015902096 6:138077952-138077974 CTCTGGCAAGGCAGTCCTGGTGG - Intergenic
1016325564 6:142897378-142897400 CTCTGCAGATGCAGCCCTAGGGG - Intronic
1016869336 6:148801178-148801200 GTCTATTGATGCATTCCTGGGGG + Intronic
1017054147 6:150423094-150423116 CTCTGTGGATGCACACATGGTGG + Intergenic
1017303067 6:152884608-152884630 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
1018340078 6:162842773-162842795 CTCTTTTAGGGCAGTCCTGGTGG + Intronic
1019512867 7:1426742-1426764 CTGGGTTGATGGGGTCCTGGGGG + Intergenic
1020449128 7:8302291-8302313 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
1020659324 7:10964252-10964274 CTCTGGTAATGCAGGCCTGGTGG + Intergenic
1020693624 7:11389789-11389811 CTCTGGTAAGGCAGGCCTGGTGG + Intronic
1021460661 7:20883346-20883368 CTCTGTTGATGCACTCGTTTTGG - Intergenic
1021805835 7:24354097-24354119 CTCTTGTAAGGCAGTCCTGGTGG - Intergenic
1022297371 7:29068644-29068666 CTGTGGTGATGCAGTCCTGTGGG - Intronic
1024034177 7:45493620-45493642 CTCTTGTAAGGCAGTCCTGGTGG + Intergenic
1027267464 7:76502291-76502313 TGCAGATGATGCAGTCCTGGAGG - Exonic
1027319278 7:77002156-77002178 TGCAGATGATGCAGTCCTGGAGG - Intergenic
1027819565 7:83025919-83025941 CTCTTTTAGTGCAGGCCTGGTGG - Intronic
1028080507 7:86569141-86569163 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
1028412816 7:90549565-90549587 CTCTTGTAATGCAGGCCTGGTGG + Intronic
1028562163 7:92187918-92187940 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
1029810244 7:103039791-103039813 CTCTTGTAATGCAGGCCTGGTGG - Intronic
1029951790 7:104594212-104594234 CTCTGGTAAGGCAGGCCTGGTGG + Intronic
1031579028 7:123449366-123449388 CTCTTTTAGTGCAGGCCTGGTGG + Intergenic
1031711215 7:125048266-125048288 CTCTGGTAAGGCAGGCCTGGTGG - Intergenic
1032106695 7:129037609-129037631 CTTTGGTGGTGCAGTCCTGGAGG + Intronic
1033352577 7:140573678-140573700 CTGTGTTGCTGCAGGCCAGGGGG - Intronic
1033374574 7:140745675-140745697 TTCTGTTGAGGCCGTGCTGGGGG - Intronic
1033866258 7:145693358-145693380 TTCTGTTGTTGCTGTCGTGGTGG + Intergenic
1036645480 8:10609375-10609397 CTCTCTTGGTGCTGTCCTGGAGG + Exonic
1037832773 8:22199008-22199030 TTCTGTTGCTCCAGTCTTGGAGG + Intronic
1038254185 8:25935392-25935414 CTTTATTGATGCGGCCCTGGAGG - Intronic
1040374653 8:46813069-46813091 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
1040516058 8:48136148-48136170 CTCTGTTGACCCCGTTCTGGAGG + Intergenic
1040519889 8:48167533-48167555 CTCTTGTAAAGCAGTCCTGGTGG + Intergenic
1040556875 8:48487505-48487527 CTCTTGTGAGGCAGGCCTGGTGG - Intergenic
1040736227 8:50512092-50512114 CTCTTTTAGTGCAGGCCTGGTGG + Intronic
1040748517 8:50675834-50675856 CTCTTGTGAGGCAGGCCTGGTGG + Intronic
1040749742 8:50691425-50691447 CTCTTTTAGTGCAGGCCTGGTGG + Intronic
1040753102 8:50736086-50736108 CTCTGGTAAGGCAGGCCTGGTGG - Intronic
1040766634 8:50918938-50918960 CTCTTTTAGTGCAGGCCTGGTGG - Intergenic
1040769465 8:50955702-50955724 CTCTTTTAGTGCAGGCCTGGTGG - Intergenic
1040863774 8:52027292-52027314 CTCTTTTAGTGCAGGCCTGGTGG + Intergenic
1041666503 8:60450027-60450049 CTCTTGTAAGGCAGTCCTGGTGG - Intergenic
1041720892 8:60974278-60974300 CTCTGTTTGTGAAGCCCTGGTGG + Intergenic
1042486823 8:69355568-69355590 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
1043149078 8:76690784-76690806 CTCTTTAGATGCATTCCTAGTGG + Intronic
1045379645 8:101610468-101610490 CTTTGTTGATTCTGTCATGGGGG + Intronic
1045503656 8:102762520-102762542 CTTTGTTGTTGCACTCCTGGAGG + Intergenic
1045797895 8:106067039-106067061 CTCTTGTAAGGCAGTCCTGGCGG - Intergenic
1046162893 8:110390366-110390388 CTCTTGTAATGCAGGCCTGGTGG + Intergenic
1046486246 8:114892585-114892607 CTCTTTTAATGTAGGCCTGGTGG + Intergenic
1046525003 8:115372288-115372310 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
1046997469 8:120540273-120540295 GTCTGTTTAAGCAATCCTGGAGG - Intronic
1050422028 9:5475995-5476017 CTCTTGTAATGCAGGCCTGGTGG + Intergenic
1050442700 9:5682335-5682357 CTCTTTTAAGGCAGGCCTGGTGG + Intronic
1050942958 9:11483950-11483972 CTCTTGTGAGGCAGGCCTGGTGG + Intergenic
1051917366 9:22224506-22224528 CTCTTTTAGGGCAGTCCTGGTGG + Intergenic
1052082845 9:24228825-24228847 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
1052124893 9:24763253-24763275 CTCTTATAATGCAGGCCTGGTGG + Intergenic
1052267405 9:26590489-26590511 CTCTGTTGGGGCAGTGCTGAAGG - Intergenic
1052865541 9:33462732-33462754 CAATGTTGAAGCAATCCTGGAGG - Exonic
1053533743 9:38905836-38905858 CTCTGGTGTTGCAGTGGTGGGGG - Intergenic
1054205969 9:62130265-62130287 CTCTGGTGTTGCAGTGGTGGGGG - Intergenic
1054632391 9:67458105-67458127 CTCTGGTGTTGCAGTGGTGGGGG + Intergenic
1054719570 9:68591363-68591385 CTCTGGTAAGGCAGGCCTGGTGG + Intergenic
1054942256 9:70755788-70755810 CTCTGGTGAGGCAGGCCTGGTGG - Intronic
1055745621 9:79440788-79440810 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
1055787415 9:79885239-79885261 CTCTGTAGATGCAGATTTGGGGG - Intergenic
1056384936 9:86088938-86088960 CTCTTGTAAGGCAGTCCTGGTGG + Intronic
1057839325 9:98472775-98472797 TTGTGTTGATGCTCTCCTGGAGG - Intronic
1059536536 9:115086206-115086228 CCCTGTTGCTGCAGTCCCTGGGG + Exonic
1061752843 9:132792710-132792732 CTTTCTGGATGCAGTCCTGCTGG + Exonic
1062001212 9:134216673-134216695 CTCTGTTGCTGCCGTGCAGGAGG - Intergenic
1203443855 Un_GL000219v1:35928-35950 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
1203485379 Un_GL000224v1:48410-48432 CTCTGTCTCTGCAATCCTGGGGG + Intergenic
1203355061 Un_KI270442v1:129645-129667 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
1203398019 Un_KI270519v1:45696-45718 CTCTTTTAGGGCAGTCCTGGTGG - Intergenic
1203514663 Un_KI270741v1:154837-154859 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
1203713633 Un_KI270742v1:122267-122289 CTCTTGTAAGGCAGTCCTGGTGG + Intergenic
1186161167 X:6778567-6778589 CCCTTTTGATGCAGTACTTGAGG + Intergenic
1186599509 X:11022149-11022171 CTCTTTTGGGGCAGGCCTGGTGG + Intergenic
1186960743 X:14734399-14734421 CTCTGGTAAGGCAGGCCTGGTGG + Intergenic
1187645416 X:21341526-21341548 CTCTTTTGGGGCAGGCCTGGTGG - Intergenic
1187954529 X:24503756-24503778 CTCTGCTGATACAGTCTTGATGG + Intronic
1188084344 X:25884295-25884317 CTCTTGTGAGGCAGGCCTGGTGG - Intergenic
1189590836 X:42508983-42509005 CTCTTGTAATGCAGGCCTGGTGG - Intergenic
1189881908 X:45502950-45502972 GTCTGGTGATGCAGTCCATGGGG - Intergenic
1190968920 X:55330164-55330186 CACTGTTATTGCAGTCCTGCAGG + Intergenic
1191027692 X:55932544-55932566 CTCTTGTAATGCAGGCCTGGTGG + Intergenic
1191077867 X:56475179-56475201 CTTTGTTGATGCTACCCTGGTGG + Intergenic
1191093744 X:56653221-56653243 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
1191186264 X:57615626-57615648 CTCTTATGAGGCAGGCCTGGTGG - Intergenic
1191208298 X:57856952-57856974 CTCTTTTAAAACAGTCCTGGTGG - Intergenic
1191589736 X:62869394-62869416 CTCTTTTGGGGCAGGCCTGGTGG + Intergenic
1191645887 X:63480285-63480307 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
1191707805 X:64112914-64112936 CTCTTTTAGGGCAGTCCTGGTGG + Intergenic
1191748723 X:64517921-64517943 CTCTTTTAGGGCAGTCCTGGTGG - Intergenic
1191886370 X:65892833-65892855 CTCTTGTAAGGCAGTCCTGGTGG + Intergenic
1191907207 X:66106478-66106500 CTCTTGTGAGGCAGGCCTGGTGG + Intergenic
1191912911 X:66170599-66170621 TGCTGTTCATGCAGTCCTTGTGG + Exonic
1191947954 X:66555834-66555856 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
1192027762 X:67473263-67473285 CTCTTTTAAAGCAGCCCTGGTGG + Intergenic
1192207442 X:69105767-69105789 CACTGTTGAGGGAGTCCTGGTGG - Intergenic
1192761113 X:74097568-74097590 CTCTTTTAGGGCAGTCCTGGTGG + Intergenic
1192948955 X:75996297-75996319 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
1192952991 X:76037777-76037799 CTCTTGTGAGGCAGACCTGGTGG + Intergenic
1192957989 X:76094014-76094036 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
1192977464 X:76301589-76301611 CTCTTGTAATGCAGGCCTGGTGG + Intergenic
1193003498 X:76589799-76589821 CTCTTGTAATGCAGGCCTGGTGG + Intergenic
1193038634 X:76980561-76980583 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
1193050206 X:77091223-77091245 CTCTTTTAGGGCAGTCCTGGTGG - Intergenic
1193054508 X:77136155-77136177 CTCTTTTAGGGCAGTCCTGGTGG + Intergenic
1193434154 X:81451220-81451242 CTCTTTTAAGGCAGGCCTGGTGG - Intergenic
1193483923 X:82062084-82062106 CTCTGCTAAGGCAGGCCTGGTGG - Intergenic
1193906964 X:87255516-87255538 CTCTTGTAAGGCAGTCCTGGTGG - Intergenic
1194954215 X:100160760-100160782 CTCTTGTAAGGCAGTCCTGGTGG + Intergenic
1195021217 X:100830835-100830857 CTCAATTGATGCAGGCCCGGCGG - Intronic
1195125909 X:101809864-101809886 CTCTGTTAGGGCAGGCCTGGTGG + Intergenic
1195170698 X:102265248-102265270 CTCTGTTAGGGCAGGCCTGGTGG - Intergenic
1195172716 X:102284760-102284782 CTCTGGTAATGCAGATCTGGGGG + Intergenic
1195186150 X:102402335-102402357 CTCTGGTAATGCAGATCTGGGGG - Intronic
1195188161 X:102421851-102421873 CTCTGTTAGGGCAGGCCTGGTGG + Intronic
1195406706 X:104522556-104522578 CTTTGTTGATGCAGCACTTGGGG + Intergenic
1195827951 X:109023498-109023520 CTCCGGTAATGCAGGCCTGGTGG + Intergenic
1195842950 X:109193989-109194011 CTCTTATGAGGCAGGCCTGGTGG - Intergenic
1195856029 X:109333996-109334018 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
1196367744 X:114942641-114942663 GTCTGTTGATGCATGCCGGGAGG + Intergenic
1196615313 X:117761358-117761380 CTCTTTTAAGGCAGGCCTGGTGG + Intergenic
1197506205 X:127307752-127307774 CTCTCTTAAGGCAGGCCTGGTGG - Intergenic
1198060360 X:133040367-133040389 CTCTTGTAATGCAGGCCTGGTGG + Intronic
1201371287 Y:13267690-13267712 CTCTTTTAAGGCAGGCCTGGTGG + Intronic
1201536243 Y:15051859-15051881 CTCTTTTAAGGCAGTCCTGATGG + Intergenic
1202344207 Y:23904553-23904575 CTCTTTTGGGGCAGGCCTGGTGG + Intergenic
1202526561 Y:25765530-25765552 CTCTTTTGGGGCAGGCCTGGTGG - Intergenic