ID: 982342623

View in Genome Browser
Species Human (GRCh38)
Location 4:154318723-154318745
Sequence ATGTATGTTCATAGAGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982342621_982342623 25 Left 982342621 4:154318675-154318697 CCACAAAACAATGATGAAAGAAA 0: 1
1: 24
2: 202
3: 415
4: 1505
Right 982342623 4:154318723-154318745 ATGTATGTTCATAGAGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982342623 Original CRISPR ATGTATGTTCATAGAGTGAA AGG Intronic
No off target data available for this crispr