ID: 982342962

View in Genome Browser
Species Human (GRCh38)
Location 4:154323508-154323530
Sequence TCTAGGCTGTGCATCAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982342962 Original CRISPR TCTAGGCTGTGCATCAGTGG GGG (reversed) Intronic
902088825 1:13885671-13885693 TGTAGGCTGTTCTTCAGTGTGGG + Intergenic
902739156 1:18422707-18422729 TATAGGCAGAGCAGCAGTGGGGG - Intergenic
903211507 1:21821854-21821876 TACAGGCTGTGCTGCAGTGGAGG - Intronic
904054805 1:27662975-27662997 TCTTGGCTGGGCAGCAGAGGGGG - Intergenic
905537925 1:38738120-38738142 TGTAGGCTGTGCACCTGTGAGGG - Intergenic
905637491 1:39564592-39564614 CCTAGGCTGTGCCTCAGAGTGGG + Intronic
907252231 1:53147100-53147122 TCTATGCTGGGCAACAGTGTAGG + Intergenic
913228671 1:116722543-116722565 TCTAGTCAAGGCATCAGTGGTGG + Intergenic
914417877 1:147501178-147501200 ACTAGTCTGTGCACCAGTGGAGG + Intergenic
914760184 1:150592470-150592492 TCTTGGCTCTGAATCAGGGGTGG - Intergenic
916399473 1:164430695-164430717 TCCAGGCTGTTCATGAGAGGAGG - Intergenic
920667050 1:207970713-207970735 TCGAGGCTATGCTTTAGTGGAGG + Intergenic
920985177 1:210882107-210882129 TGGAGGCTGTGCATGGGTGGGGG + Intronic
922709109 1:227813826-227813848 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
1065639535 10:27767865-27767887 TCCAGGCTGTACCACAGTGGGGG + Intergenic
1065698341 10:28401076-28401098 GCAAGGCTGTGCATCCCTGGAGG + Intergenic
1068604512 10:58990424-58990446 ACTAGACAGTGCCTCAGTGGGGG - Intergenic
1069106120 10:64385136-64385158 ACTAGGCAGTGCTCCAGTGGGGG + Intergenic
1072690314 10:97568462-97568484 GCTAGGCTGAGGCTCAGTGGTGG + Intronic
1073751106 10:106527956-106527978 ACTAGGCATTGCATTAGTGGGGG - Intergenic
1078064987 11:8072339-8072361 CCTAGGCAGGGCAGCAGTGGTGG + Intronic
1078296428 11:10076081-10076103 GCTACGCTGTGGATCTGTGGTGG + Intronic
1080584732 11:33671318-33671340 TCCATGCTCTGCATCAGGGGAGG + Exonic
1081964843 11:47163222-47163244 TATGGGCTGTGCATCATTGTGGG - Intronic
1082798802 11:57398367-57398389 TGTAGACAGTGCATCAGAGGTGG - Intronic
1083519566 11:63295890-63295912 TCTGGGCTTAGGATCAGTGGTGG - Intronic
1085088520 11:73689810-73689832 TCTCGACTGTGCCTCTGTGGAGG + Intronic
1087336621 11:96852038-96852060 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
1087675656 11:101158410-101158432 ACCAGGCTGTGCTCCAGTGGGGG - Intergenic
1088754012 11:112870640-112870662 TGTAGACTGTGCCTCAGTTGGGG + Intergenic
1089310574 11:117555742-117555764 TTTAGCCTGTGCATAGGTGGTGG + Intronic
1089582069 11:119487682-119487704 TTCAGGCTGTGCATGTGTGGAGG - Intergenic
1091804558 12:3346657-3346679 CCCAGCCTGTGCCTCAGTGGTGG - Intergenic
1095950572 12:47779697-47779719 TCCAGGCTGTGGAACAGTAGTGG + Intronic
1096452419 12:51755530-51755552 TCTAGGCTGAGTATCAGCTGAGG + Intronic
1097865690 12:64557541-64557563 TCTAGGCTCTGCAGAATTGGAGG - Intergenic
1098126928 12:67306416-67306438 TATTAGCTCTGCATCAGTGGTGG + Exonic
1099760320 12:86912548-86912570 ACTAGGCAGTGTCTCAGTGGGGG - Intergenic
1104246176 12:127043609-127043631 TCTAGGCTGAGCCACAGTGAAGG + Intergenic
1104500394 12:129279740-129279762 TCTAAGTTGTGCAGCAGTGCTGG - Intronic
1104751465 12:131242745-131242767 TCTGGGCTGAGCAACAGGGGAGG + Intergenic
1105640077 13:22252939-22252961 TCCAGGCTGGGCAACAGTGTGGG - Intergenic
1113269314 13:108655534-108655556 ACTAGGCAGTGCCCCAGTGGAGG - Intronic
1114702431 14:24692818-24692840 TCAAAGCTGGGCATCAGAGGAGG + Intergenic
1117855113 14:60022759-60022781 TCTAAACTGTGCATTATTGGAGG - Exonic
1119907272 14:78317259-78317281 CCCAGGCTGTGGACCAGTGGTGG + Intronic
1121705489 14:95990144-95990166 TGTAGGCAGTGAATCAGTGTTGG - Intergenic
1126161881 15:45621190-45621212 TCTAGGCTCTGCATGATTGGAGG + Intronic
1127217301 15:56836998-56837020 TCTTGGCTGTGCCTCTATGGAGG - Intronic
1129702018 15:77773661-77773683 TCGAGCCTGTGTATCAGTGCTGG - Intronic
1134343303 16:13365497-13365519 CCTAGGCTGTAGAACAGTGGCGG + Intergenic
1135471200 16:22732723-22732745 TCCAGGCTGTGCATGAGTTTAGG - Intergenic
1135955878 16:26955826-26955848 TCTTGGCAGTGCCTCAGAGGGGG + Intergenic
1135962422 16:27008196-27008218 TCAAGACTGTGCATTACTGGTGG + Intergenic
1143115577 17:4580175-4580197 TGGAGGCTGTGCAGGAGTGGGGG - Intergenic
1144708474 17:17385146-17385168 TGCAGGCTGTGCAGGAGTGGAGG + Intergenic
1146930257 17:36771905-36771927 TCTGGTCTGTTGATCAGTGGAGG - Intergenic
1146932915 17:36790932-36790954 TCTAGGCTATGCCTTATTGGAGG - Intergenic
1147792491 17:43022168-43022190 ACTAGGCAGCGCAGCAGTGGCGG + Exonic
1148915182 17:50970733-50970755 TCTATGCTTGTCATCAGTGGAGG - Exonic
1150518142 17:65836837-65836859 CCTCGGCTGGGCATCAGAGGGGG - Intronic
1153407934 18:4761090-4761112 TCTGGGCTCTGCAGCACTGGAGG + Intergenic
1154112478 18:11582007-11582029 CCTGGGCTGTACAACAGTGGGGG - Intergenic
1157202290 18:45669232-45669254 ACTAGACTGTGCTGCAGTGGGGG - Intronic
1163722636 19:18905530-18905552 TCTGGGCTGTGGCTCAGTGCGGG + Intronic
1168306515 19:55438874-55438896 TCTAGCCTGGGCACCAGGGGGGG - Intronic
925043228 2:750414-750436 TCTAGCCTGGGCATCAGAGCAGG - Intergenic
927077003 2:19588716-19588738 CCTAGGCTGTGAATTTGTGGAGG - Intergenic
927205903 2:20610128-20610150 GCGAGGCTGTGCATGTGTGGGGG - Intronic
927270265 2:21200042-21200064 TCTAAGCTGAGTATCAGTGCCGG - Intergenic
929021672 2:37559598-37559620 GATAGGCTGTGCATGTGTGGGGG + Intergenic
929130696 2:38566920-38566942 ACCAGACTGTTCATCAGTGGGGG + Intronic
931154137 2:59608378-59608400 ACTAGGCAGTGCTTTAGTGGGGG - Intergenic
932311595 2:70746814-70746836 CCCAGGCTGTGGGTCAGTGGTGG - Intronic
934851118 2:97701844-97701866 CCAAGGCTCTGCTTCAGTGGTGG + Intergenic
938558677 2:132450258-132450280 TCTATGCTGATCAGCAGTGGTGG - Intronic
939618391 2:144386873-144386895 TCTAGGCTGTGGATAACAGGAGG + Intergenic
942664745 2:178305388-178305410 TGTTGGCTGTGCATAAGTGAAGG + Intronic
943876200 2:193071142-193071164 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
944272573 2:197800091-197800113 TCTGGCTTCTGCATCAGTGGGGG + Intergenic
944512194 2:200475720-200475742 TCTAGGCTCTGAATTATTGGGGG + Intronic
945950608 2:216035414-216035436 GCATGGCTGTGAATCAGTGGAGG - Intronic
946969725 2:225078547-225078569 TCTAATCTGTGCAGCAGTGTTGG + Intergenic
948539973 2:238684010-238684032 TATAGAATGTGCATCAGTGTTGG + Intergenic
1169275874 20:4233428-4233450 TCTAGTCTGGGCAACAGAGGTGG + Intronic
1169425259 20:5491879-5491901 TCTATGCTGGCCAGCAGTGGAGG + Intergenic
1169992633 20:11520443-11520465 TCTTGGCTGTGAATCAGTACAGG + Intergenic
1171091104 20:22286394-22286416 TCCAGGCTGTGCTTCTCTGGGGG - Intergenic
1175800722 20:61799805-61799827 TTTGGGCTGAGCATCAGTGAAGG - Intronic
1179148043 21:38786080-38786102 TCTGGGCTGGGGGTCAGTGGGGG + Intergenic
1182240616 22:28913204-28913226 TCTATGCTATGCATTAATGGTGG + Intronic
1184888926 22:47367704-47367726 TCTGGGCTAGGGATCAGTGGGGG - Intergenic
953404919 3:42655284-42655306 TCTATGCTGGGCAGCAGTGGGGG - Intronic
953551715 3:43908423-43908445 TCCAGGCTGAGCATCTATGGTGG + Intergenic
956261781 3:67351091-67351113 TGCAGGCTGTTCATCAGTGGTGG - Intergenic
960003255 3:112754881-112754903 TTTAGGCTCTGCTGCAGTGGAGG - Intronic
960273193 3:115696861-115696883 TCTAGCCTGGGCAACAATGGTGG - Intronic
961454229 3:127016294-127016316 GCCAGGCTGGGCAACAGTGGGGG + Intronic
961549857 3:127663135-127663157 TCTTGGCTGTGCAGCACTGCGGG + Intronic
963538911 3:146562239-146562261 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
969479385 4:7439885-7439907 TGTAGGGTGTGCACCTGTGGGGG + Intronic
969997096 4:11324307-11324329 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
971664304 4:29461942-29461964 ACTAAGCTGCCCATCAGTGGTGG + Intergenic
973864819 4:55101915-55101937 TCTTGGCTGTGCAAAAGTGGAGG - Exonic
974716897 4:65679181-65679203 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
976715669 4:88120308-88120330 ACTAAGCAGTGCCTCAGTGGGGG - Intronic
978986203 4:115015832-115015854 GGCAGACTGTGCATCAGTGGTGG - Intronic
981015263 4:139967866-139967888 CCTAGGGTGTGTATCTGTGGGGG - Intronic
981347808 4:143697091-143697113 TTTAGGCTGCTCATCATTGGTGG + Exonic
982342962 4:154323508-154323530 TCTAGGCTGTGCATCAGTGGGGG - Intronic
982933913 4:161446169-161446191 TTTTGGGTGGGCATCAGTGGTGG - Intronic
982987744 4:162232199-162232221 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
984222696 4:176996994-176997016 TCCAGGCTGTGCTTCACAGGGGG - Intergenic
986014706 5:3747781-3747803 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
987155330 5:15083424-15083446 TCTAGACTGAGCAGCAGAGGTGG - Intergenic
989130597 5:38103220-38103242 TTTAGGCAGTGCCTCACTGGTGG - Intergenic
991673728 5:69072714-69072736 TCTAGCCTGGGCAACAGTGTGGG + Intergenic
992622234 5:78605334-78605356 TCCAGGCAGTGCATCAGTGCTGG - Intronic
992775339 5:80084196-80084218 TCCAGGCTGTACATGAGAGGAGG - Intergenic
993117545 5:83735638-83735660 ACTAGGCAGTGCACCAGTGGCGG - Intergenic
993967149 5:94372293-94372315 GCTAGGCAGTGCCCCAGTGGGGG + Intronic
995158247 5:108942000-108942022 TGGAGGCTGTGCATGTGTGGGGG + Intronic
995373081 5:111442123-111442145 TCTAGGCTAGGCATCCCTGGAGG + Intronic
996098142 5:119420749-119420771 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
997896590 5:137723991-137724013 TCTTGCCTGTGCATCAAGGGTGG + Intronic
1001367916 5:171162742-171162764 TCTTAGCCATGCATCAGTGGAGG + Intronic
1003563695 6:7204465-7204487 TGTAGGTTGTGCAGCTGTGGGGG + Intronic
1010055149 6:71556377-71556399 ACTAGGCAGTGCTTCAGTGTGGG - Intergenic
1017432554 6:154385351-154385373 TCCAGGCTGTGCTGCAGTGTAGG - Intronic
1017732940 6:157334121-157334143 TCTAACCTGTCCCTCAGTGGAGG - Intergenic
1018527493 6:164729086-164729108 ACTAGGCAGTGCCTCAGTGAAGG - Intergenic
1019384174 7:744972-744994 TCTTGTCTCTGCATCAGTGATGG + Intronic
1021714318 7:23447579-23447601 TCTAGGCTGGACTGCAGTGGTGG - Intronic
1021946788 7:25735583-25735605 TCTGGGCTGTTCAGCAGTGAAGG - Intergenic
1023549421 7:41353338-41353360 TCTAGACTGAGCCTCAGTCGTGG + Intergenic
1027584781 7:80044629-80044651 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
1031519061 7:122740541-122740563 TGTAGGCTATGCATGTGTGGGGG + Intronic
1034312292 7:150099545-150099567 CCTAGGCTGTGCCTCACTGCTGG + Intergenic
1034794560 7:154001113-154001135 CCTAGGCTGTGCCTCACTGCTGG - Intronic
1035414376 7:158670519-158670541 TCTAGCCTGGGCATCAGAGTGGG + Intronic
1037583882 8:20263259-20263281 TCGAGGCTCTGCACCAGTGAAGG - Intronic
1043787037 8:84416354-84416376 ACTAGTCTGTGCAGGAGTGGAGG + Intronic
1045422127 8:102026719-102026741 ACTAGGCAGTGCCCCAGTGGAGG + Intronic
1046146848 8:110171977-110171999 ACTAGGCAGTGCACCAGTGGGGG - Intergenic
1046558899 8:115813836-115813858 TCTAGGCTGTGGAGCAGGGAGGG + Intergenic
1047411989 8:124631428-124631450 TCTGAGCTGTGCAGCAGTGTCGG - Intronic
1047629797 8:126694445-126694467 GCAAGGCTATGCATCTGTGGAGG - Intergenic
1049615090 8:143572505-143572527 TCCAGGCTCTGCCTCAGAGGGGG + Exonic
1050035323 9:1429510-1429532 TCTAGGCTTTGCAACAGTGAAGG + Intergenic
1050318331 9:4425802-4425824 CCACCGCTGTGCATCAGTGGAGG - Intergenic
1051910841 9:22153384-22153406 TCTAGGAGCTGCATCAGTTGGGG + Intergenic
1056333641 9:85543597-85543619 TCTACGTTGTGCAGCAGTGATGG - Intergenic
1056821961 9:89848809-89848831 TCCAGGATGTGCCTCAGTGAGGG + Intergenic
1056832776 9:89930243-89930265 CCTAGACTGTGCAGCAGTAGGGG - Intergenic
1057496084 9:95562615-95562637 TCTGGGCTTTGCATCAGTGCCGG - Intergenic
1058500126 9:105604923-105604945 TCTAGGCTGGGCAACAGAGCAGG + Intronic
1058707423 9:107648979-107649001 TCTAAGCTGTCCATCACTGGGGG + Intergenic
1061313782 9:129781187-129781209 TCTAGGCTGGGGTACAGTGGCGG - Intergenic
1061470226 9:130819031-130819053 TCAAGACTGTGCATCCTTGGAGG + Intronic
1062351457 9:136141640-136141662 TCTAGCCTGGGCAACAGAGGGGG + Intergenic
1189435712 X:40990949-40990971 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
1191914985 X:66191896-66191918 TCTAGTAAATGCATCAGTGGTGG + Intronic
1191987711 X:67000549-67000571 ACTAGGCAGTGCCCCAGTGGAGG + Intergenic
1193865040 X:86720734-86720756 TCTAGGCAGTGCCCCAGTGGGGG + Intronic
1195272188 X:103242833-103242855 TTGGAGCTGTGCATCAGTGGTGG - Intergenic
1195536337 X:106012984-106013006 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
1200137530 X:153882298-153882320 CCCAGGCTGTGCTTCAGTGGAGG - Intronic