ID: 982350370

View in Genome Browser
Species Human (GRCh38)
Location 4:154408836-154408858
Sequence AAGTGGTGATGAGGACTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 236}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982350370_982350378 15 Left 982350370 4:154408836-154408858 CCCAGCAGTCCTCATCACCACTT 0: 1
1: 0
2: 4
3: 29
4: 236
Right 982350378 4:154408874-154408896 CTCACCACTGGGAACATCTGAGG 0: 1
1: 0
2: 1
3: 15
4: 186
982350370_982350380 27 Left 982350370 4:154408836-154408858 CCCAGCAGTCCTCATCACCACTT 0: 1
1: 0
2: 4
3: 29
4: 236
Right 982350380 4:154408886-154408908 AACATCTGAGGTTCTCACAGAGG 0: 1
1: 0
2: 0
3: 16
4: 144
982350370_982350374 3 Left 982350370 4:154408836-154408858 CCCAGCAGTCCTCATCACCACTT 0: 1
1: 0
2: 4
3: 29
4: 236
Right 982350374 4:154408862-154408884 ACACCTACAGACCTCACCACTGG 0: 4
1: 14
2: 11
3: 39
4: 162
982350370_982350375 4 Left 982350370 4:154408836-154408858 CCCAGCAGTCCTCATCACCACTT 0: 1
1: 0
2: 4
3: 29
4: 236
Right 982350375 4:154408863-154408885 CACCTACAGACCTCACCACTGGG 0: 3
1: 10
2: 10
3: 34
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982350370 Original CRISPR AAGTGGTGATGAGGACTGCT GGG (reversed) Intronic
900044852 1:497336-497358 AAATTGTAATGAGGTCTGCTGGG + Intergenic
900066254 1:732244-732266 AAATTGTAATGAGGTCTGCTGGG + Intergenic
900066651 1:735650-735672 AAATTGTAATGAGGTCTGCTGGG + Intergenic
900067047 1:739066-739088 AAACTGTGATGAGGTCTGCTGGG + Intergenic
902070599 1:13732072-13732094 AAGTGATGCTGTTGACTGCTGGG + Intronic
902642613 1:17776373-17776395 AGCTGATGGTGAGGACTGCTGGG + Intronic
902856799 1:19212411-19212433 TAGTGATGAGGAGGCCTGCTGGG + Intergenic
904402192 1:30264081-30264103 AAGTGGTAAAGAGGGCTGCCTGG - Intergenic
904463111 1:30692248-30692270 AGGTGGAGATGAGGACGGATAGG + Intergenic
904463903 1:30696862-30696884 AGGTGGAGGTGAGGACTTCTTGG - Intergenic
904498134 1:30898976-30898998 AGGTGGTGGTGAGGAGTGGTGGG - Intronic
905162159 1:36046050-36046072 AGGTGTTGATGGGGATTGCTGGG - Intronic
905663009 1:39742751-39742773 AAGTGGTGATGAAGATTTCGTGG - Intronic
907023089 1:51087466-51087488 CAGTGGTGATGAGGGCTGCTGGG + Intergenic
909101859 1:71358134-71358156 AATTGGTAAGGGGGACTGCTTGG - Intergenic
909938933 1:81588349-81588371 AAGTGGTTCTGAGGAGTGCAAGG - Intronic
910523078 1:88145685-88145707 AAGTGGTGAAGAGAGATGCTTGG - Intergenic
910876106 1:91879692-91879714 AAGTGGGGAGGAAGAATGCTTGG + Intronic
912451854 1:109772296-109772318 AAGGGATGATGATGACTGCATGG + Intronic
913550006 1:119907908-119907930 CAGTGGGAATGTGGACTGCTGGG + Intergenic
913722454 1:121611907-121611929 AAGTGGAGATTTGGACTGCTTGG - Intergenic
913742214 1:121859165-121859187 AAGTGGAGATTTGGACTGCTTGG - Intergenic
913751813 1:121976364-121976386 AAGTGGAGATTTGGACTGCTTGG - Intergenic
914848818 1:151298836-151298858 AAGTTGTGCTGGGTACTGCTTGG - Exonic
914899886 1:151706276-151706298 AGGTGGTGGTGGGGGCTGCTGGG + Exonic
921448657 1:215276615-215276637 GAATGGTGATGAAGGCTGCTAGG + Intergenic
922262452 1:223954704-223954726 AAATTGTAATGAGGTCTGCTGGG + Intergenic
922355505 1:224771542-224771564 TAGTGGTGTTGAGGGCTGTTGGG + Intergenic
923098933 1:230797029-230797051 AAGTGCTGATGTGGAGTGCATGG - Intronic
924344293 1:243059704-243059726 AAATTGTAATGAGGTCTGCTGGG + Intergenic
1063075650 10:2713684-2713706 CAGTGGTGGTGTGGACTGCAGGG - Intergenic
1063849399 10:10167898-10167920 AAGTGGTGTTGGGGGCTGATAGG - Intergenic
1065976519 10:30847024-30847046 AAGGGGTGCTCAGGACAGCTCGG + Intronic
1066236480 10:33489930-33489952 AAGGGTTGATGAGAACTGCTAGG - Intergenic
1067762424 10:49058278-49058300 AAGTTGTGAGGAGGACTGAAGGG - Intronic
1067969679 10:50955104-50955126 AAGTGGTGAGGAGGAGAGCATGG + Intergenic
1068539129 10:58271370-58271392 AAGTTGTCATGAGGACTGTAGGG + Intronic
1068977257 10:63023238-63023260 ATTTGGTGATGATGCCTGCTGGG - Intergenic
1069881697 10:71597427-71597449 AAGTAATGGTGAGGACAGCTGGG - Intronic
1072455075 10:95568395-95568417 AAGTGGAGATGCAGAGTGCTGGG + Intergenic
1074080128 10:110161804-110161826 AGGTGGTGCTGAGTACTGCCTGG - Intergenic
1074991590 10:118713063-118713085 AAGGGGTGCTGAGGGCAGCTTGG - Intronic
1075844483 10:125534398-125534420 AGCTGGTGATGAGGATGGCTGGG + Intergenic
1076673743 10:132136988-132137010 AACTTGTGATGTGGGCTGCTTGG + Intronic
1076971177 11:133827-133849 AAACTGTGATGAGGTCTGCTGGG + Intergenic
1077798643 11:5516701-5516723 AAGTGGTGATGACTTCTCCTAGG + Exonic
1078857082 11:15215144-15215166 AAGTGGTGATGAGGATGGCCTGG - Intronic
1080907429 11:36560735-36560757 CAGTGGTAATGAGGACTGCTAGG + Intronic
1081483835 11:43512489-43512511 GAGAGGTGATCAGGAATGCTAGG - Intergenic
1081973206 11:47214395-47214417 AATTGGTGATGACGCCCGCTCGG - Intergenic
1082163525 11:48912290-48912312 AAGTGGATATGTGGACTTCTTGG - Intergenic
1082165087 11:48938996-48939018 AAGTGGATATGTGGACTGCTTGG - Intergenic
1083903554 11:65655607-65655629 CAGTGGAGATGAAGACTCCTGGG - Intronic
1084161547 11:67353135-67353157 AAGCGGTGGTGAGGAAGGCTGGG - Intronic
1087385181 11:97461583-97461605 AAGTGGGGCTGAGGGCAGCTTGG + Intergenic
1088548319 11:110984611-110984633 CAGTGTTGATGAGGACTTCAAGG + Intergenic
1090452775 11:126821259-126821281 CAGTGGTGAGAAGCACTGCTGGG - Intronic
1090722557 11:129489854-129489876 ATGTGGTGATGTGGACTCCAGGG - Intergenic
1090876373 11:130792072-130792094 CAGTGGTGGTGAGGGCTTCTGGG + Intergenic
1091128959 11:133128001-133128023 CTGTGGTGATGTGGACTGATGGG - Intronic
1091769702 12:3142980-3143002 CAGTGGTGAGGAGTGCTGCTCGG + Intronic
1092313275 12:7382553-7382575 CAGTGGGAATGTGGACTGCTAGG - Intronic
1093386075 12:18556096-18556118 AAGTGTTTATCAAGACTGCTTGG + Intronic
1093473275 12:19528066-19528088 AAGTGGTGGTCAGGAATGATTGG + Intronic
1095192568 12:39274358-39274380 AAGTGGTGTTGAGGATGGATGGG - Intergenic
1097031948 12:56096239-56096261 AAGTGGGGAAGGGGACAGCTAGG - Intronic
1099227223 12:79983673-79983695 AAGTGGTGGTGAGCAATGCTTGG + Intergenic
1100792231 12:98143273-98143295 AAATGGAGATGAGGAGTGCCAGG + Intergenic
1102345891 12:112161305-112161327 ATGGGGTGATGGGGAGTGCTGGG + Exonic
1104045317 12:125158491-125158513 AGGTGGTGCTGAGGCCTTCTTGG + Intergenic
1108499187 13:51053972-51053994 AAGTGGTCCTGAGGACTGGGTGG - Intergenic
1109615979 13:64834243-64834265 CAGTGGTGATGGGGATTGATTGG + Intergenic
1109762245 13:66845238-66845260 AAGTGGGGCTGAGGGCAGCTTGG - Intronic
1109969682 13:69751492-69751514 ATGTGGGGATGAGGAATTCTTGG + Intronic
1110697404 13:78507538-78507560 CAATGGTGATGAGAACTGCTAGG + Intergenic
1112061364 13:95742515-95742537 CAGTGGCAATGTGGACTGCTGGG + Intronic
1112813479 13:103246486-103246508 ACTTTGTGCTGAGGACTGCTGGG + Intergenic
1114000006 14:18226479-18226501 AAGTGGAGATATGGAGTGCTTGG - Intergenic
1115303864 14:31914232-31914254 CGGTGGTGATGGGGGCTGCTGGG + Intergenic
1115652705 14:35414598-35414620 AAATGGTGATGAGGAGTGGCTGG - Intergenic
1116313788 14:43360400-43360422 AAGTGGCACTGAGGGCTGCTTGG - Intergenic
1116774336 14:49162756-49162778 AAGTGGAAATGAGGAACGCTGGG + Intergenic
1117777693 14:59199386-59199408 AAGTGGTGATCAGCCCTGCACGG - Intronic
1118568729 14:67171888-67171910 AAGTGTTGATGGGGGTTGCTGGG - Intronic
1119891898 14:78189206-78189228 AAGTGGTGGTGGGGGCGGCTTGG - Intergenic
1121091941 14:91188980-91189002 CAGTGGTGATGAGCACTGAGCGG - Exonic
1121789771 14:96690356-96690378 AAGGGGTGGTGAGCCCTGCTGGG - Intergenic
1122084621 14:99290977-99290999 CTGGGGTGATGAGGACTGCGTGG - Intergenic
1127524516 15:59779085-59779107 AATTGGGGATGTGGACTTCTTGG + Intergenic
1128563274 15:68682562-68682584 ATGCTGTGCTGAGGACTGCTGGG + Intronic
1128641627 15:69342635-69342657 TGGAGGTGGTGAGGACTGCTGGG + Intronic
1134417006 16:14052863-14052885 GAGTGGGGATGAGGACAGGTTGG - Intergenic
1136270720 16:29146730-29146752 AACTGGTGAAGGGGACTTCTGGG + Intergenic
1137270596 16:46900232-46900254 AGGGGGTGATGAGGAATGCAGGG + Intronic
1137390374 16:48076190-48076212 AACTAGGGCTGAGGACTGCTTGG - Intergenic
1139183083 16:64770549-64770571 AGGTGGTGCTGAGGGCAGCTTGG + Intergenic
1140689800 16:77470875-77470897 AAGTGGTCAAGAGCATTGCTGGG + Intergenic
1142458417 17:71594-71616 AAATTGTAATGAGGTCTGCTGGG + Intergenic
1142742635 17:1940061-1940083 CAGTGGCGGTGAGGCCTGCTGGG - Intronic
1143451230 17:7038114-7038136 AAGTGGTGTTGAGAACTCTTAGG - Intronic
1143531637 17:7508474-7508496 AGGTAGGGATCAGGACTGCTGGG + Exonic
1143759111 17:9088330-9088352 AAGTGGGGATCAGGAGTTCTGGG + Intronic
1146314935 17:31799486-31799508 AAGTGGTGATGAGGACAGAAGGG - Intergenic
1146403502 17:32518769-32518791 ACCTGGTGATGAAGAGTGCTGGG - Intronic
1147706684 17:42430088-42430110 AAGAGGAGATGAGCAGTGCTTGG - Intergenic
1148791373 17:50175157-50175179 AAGTGGTGGGGAGGACCGCAGGG + Intronic
1149304366 17:55334158-55334180 AAGATGTGATGAGGATTGTTTGG - Intergenic
1153066574 18:1051985-1052007 GAGTGGAGATGAGGGTTGCTGGG + Intergenic
1154102165 18:11486224-11486246 AAGAGGTGATGAACACTGCCAGG + Intergenic
1155414505 18:25582314-25582336 AAGTGGTGATGCAGACCACTGGG + Intergenic
1155538882 18:26845920-26845942 AAGTGGTGATTAGGACTCACAGG + Intergenic
1155659086 18:28226731-28226753 AGATGTTGATGAGGTCTGCTTGG + Intergenic
1157059055 18:44265529-44265551 TGGTGGTAATGAGGACTGTTGGG - Intergenic
1159161392 18:64646956-64646978 AAGGGGTGCTGAGGGCTGTTTGG - Intergenic
1160452935 18:78978354-78978376 AAGTGGCGATAGGGACTGTTTGG + Intergenic
1160648133 19:204107-204129 AAACTGTGATGAGGTCTGCTGGG + Intergenic
1164346821 19:27273763-27273785 AAGTGGATATTTGGACTGCTTGG + Intergenic
925709060 2:6720156-6720178 AAGTGGAGAAGGGGAGTGCTAGG - Intergenic
925941745 2:8827363-8827385 GAGTGGTGATGAGGAGGGTTTGG - Intronic
926135481 2:10332799-10332821 AGGTGGGGATGAGGACTGATTGG + Intronic
926273510 2:11386071-11386093 AAGTGGAGATGAGGTCATCTTGG + Intergenic
927176385 2:20411747-20411769 AGGTGGTGATGAGGGTTGCTGGG + Intergenic
929009126 2:37423839-37423861 AAGAGAGGAAGAGGACTGCTGGG + Intergenic
930950995 2:57144843-57144865 ACTTGGGGATGTGGACTGCTGGG - Intergenic
931391434 2:61847388-61847410 CAATGGTGATGAGTACTTCTGGG - Intronic
934580106 2:95430975-95430997 AAGTGGTGATGGGGATGGGTGGG - Intergenic
934599341 2:95645750-95645772 AAGTGGTGATGGGGATGGGTGGG + Intergenic
935869122 2:107426247-107426269 AAGAGGTGATGAGGTCATCTGGG - Intergenic
939407471 2:141777062-141777084 AGGTGGGGGTTAGGACTGCTAGG + Intronic
941297852 2:163762467-163762489 AAATGGTTATGTGGAGTGCTCGG - Intergenic
947327312 2:228992624-228992646 AAGGGGTGCTGAGGGCAGCTTGG - Intronic
948406320 2:237722755-237722777 GAGTGGTGAAGAGGCCTGCGTGG + Intronic
1170330818 20:15208785-15208807 CAGTAGTGAGGAGGCCTGCTGGG + Intronic
1171204580 20:23268819-23268841 AGGTAATGATGAGTACTGCTGGG + Intergenic
1171445858 20:25204606-25204628 AAATGGTTATGGGCACTGCTAGG - Intronic
1171614686 20:26957209-26957231 AAGTGGGTATGAGGCCAGCTTGG + Intergenic
1171639150 20:27323980-27324002 AAGTGGGTATGAGGCCAGCTTGG + Intergenic
1171640223 20:27339783-27339805 AAGTGGTTATTAGGCCAGCTTGG + Intergenic
1171808229 20:29709320-29709342 AAGTGGATATTTGGACTGCTTGG - Intergenic
1175621815 20:60453935-60453957 AAGTGGAGAGGAGGACAGCTGGG - Intergenic
1177801295 21:25831443-25831465 AAATAAGGATGAGGACTGCTGGG + Intergenic
1177960489 21:27660505-27660527 AGGTGTTGATGGGGGCTGCTGGG - Intergenic
1178817365 21:35944047-35944069 AGGTGGTGATGAGGTCAGGTGGG + Intronic
1180424469 22:15156252-15156274 AAGTGGAGATATGGAGTGCTTGG - Intergenic
1180903665 22:19393164-19393186 AAGTGGTTGTGAGGACTGCATGG + Intronic
1182070179 22:27458051-27458073 AAGTGGAGATGAGCAGTGATGGG + Intergenic
1183660114 22:39214851-39214873 AATTGGTTATCTGGACTGCTTGG + Intergenic
1183747314 22:39699092-39699114 AGGAGGTGATGAGGAGTGATGGG - Intergenic
950718335 3:14865200-14865222 AAAAGGTGCTGAGGTCTGCTGGG - Intronic
953566607 3:44037512-44037534 ATGTGGTTAGGAGGACTTCTAGG + Intergenic
953937122 3:47055333-47055355 AAGGGGTAATGAGGAGTGCTGGG + Intronic
954302232 3:49706148-49706170 GAGTGGGGATGAGAACTGCCAGG - Intronic
956548355 3:70432829-70432851 AAGTGGTTATGAGGGATTCTGGG - Intergenic
957602456 3:82355632-82355654 AAGTGGTGTTGAGGAATGGAAGG + Intergenic
958206592 3:90405414-90405436 AAGTGGATATGTGGACTGCTTGG - Intergenic
958640186 3:96795269-96795291 TAGAGGGAATGAGGACTGCTGGG + Intergenic
958769918 3:98414009-98414031 CAGTGGGAATGTGGACTGCTGGG - Intergenic
961610445 3:128133034-128133056 AAGTTGTGTTGAATACTGCTGGG - Intronic
963878580 3:150503440-150503462 AGGTGTTGATGGGGGCTGCTGGG - Intergenic
964337306 3:155669108-155669130 AAGTGGTGATGCCCACTCCTCGG - Intronic
968369714 3:198216008-198216030 AAACTGTGATGAGGTCTGCTGGG - Intergenic
969231899 4:5838030-5838052 AGGTGGGGATGAGGCGTGCTGGG + Intronic
972563667 4:40250658-40250680 AAATGGTGATGATGAGAGCTTGG + Intergenic
974316122 4:60282803-60282825 CAGTGGTAATGGGAACTGCTGGG + Intergenic
975498276 4:75057805-75057827 AAGGAGTGCTGAGGGCTGCTTGG + Intergenic
976346819 4:84013275-84013297 AAGTGGACATGATGACTGGTGGG - Intergenic
978456025 4:108892900-108892922 AAGTGGTGATGAGGAGTCAGGGG + Intronic
978839534 4:113193719-113193741 GAGTGGTGGTGAGGACTGAGAGG + Intronic
980116407 4:128683726-128683748 AAGTGGTGATGAGAACTCAGAGG - Intergenic
981584553 4:146286801-146286823 CAGTGGTGAGAAGGACTGTTTGG + Intronic
981828380 4:148971386-148971408 AAGTGGTGGTGACGAATGCAGGG - Intergenic
982063303 4:151625934-151625956 AACTGGCGATGAGAACTGGTGGG + Intronic
982350370 4:154408836-154408858 AAGTGGTGATGAGGACTGCTGGG - Intronic
984256058 4:177391441-177391463 AAGAGGCAATGAGGTCTGCTGGG + Intergenic
985214909 4:187640910-187640932 CAGTGGTGGTGAGGGCTGTTGGG - Intergenic
986453743 5:7893762-7893784 TAGTGGGGATTAGGACTTCTTGG + Intronic
986890493 5:12299132-12299154 GAGTTGTAATCAGGACTGCTGGG - Intergenic
987095070 5:14542428-14542450 TACTGGAGATGGGGACTGCTGGG + Intergenic
987095187 5:14543107-14543129 TGTTGGTAATGAGGACTGCTGGG + Intergenic
987750895 5:22037956-22037978 AGGTGTTGATGGGGACTGCTGGG - Intronic
988831640 5:34993266-34993288 AAGTGGTGTTGAAGACTGCTGGG - Intergenic
990571742 5:57085815-57085837 AAGTGGTGATGAAGTCTGCCTGG - Intergenic
997918497 5:137953649-137953671 AAGTGGTGATGAAAACAGTTTGG + Intronic
1000683307 5:164214748-164214770 AGGTGGTGATGATGGCTGGTGGG - Intergenic
1002728992 5:181321593-181321615 AAATTGTAATGAGGTCTGCTGGG - Intergenic
1003166512 6:3683685-3683707 AAGTAATGATGAGCACAGCTGGG + Intergenic
1004202160 6:13558832-13558854 AAGTGGTGTGGATGACTGTTAGG + Intergenic
1004953692 6:20702866-20702888 AAGTGGTGAAGGGAAGTGCTGGG - Intronic
1005032380 6:21523065-21523087 CAGAGTTGATGAGGACTGCATGG + Intergenic
1007357084 6:41328878-41328900 AAGAGCTGCTGAAGACTGCTAGG - Intergenic
1007717285 6:43864632-43864654 AGATGGGGATGAGGACTTCTGGG + Intergenic
1007852972 6:44823466-44823488 ATGTGGAGATGAGGTCTCCTGGG - Intronic
1009805674 6:68599017-68599039 AAGTGGTGATGGGGAGTGAATGG + Intergenic
1010607237 6:77906497-77906519 CAGTTGTGATGAGAATTGCTGGG + Intronic
1011295822 6:85826198-85826220 CAGTGGGGATGTGGACTGTTGGG - Intergenic
1013020948 6:106217529-106217551 AAGTGAAGATGAGGAGTTCTTGG - Intronic
1013366503 6:109441522-109441544 AAGCGGTGAGGATGCCTGCTTGG - Intronic
1013486273 6:110599355-110599377 AAGAGGTGATTAGGTCGGCTGGG + Intergenic
1013833420 6:114301826-114301848 AAGTGGTGATGATGAGTGGATGG - Intronic
1015258255 6:131204690-131204712 AAGTGGTGATGAGCAAAGTTAGG + Intronic
1015808108 6:137132921-137132943 AGGTGGTGATGAGGGCTGCTGGG - Intergenic
1016720844 6:147295680-147295702 CAGTGGTAATGGGGACTGTTGGG - Intronic
1017054446 6:150424763-150424785 AAGGGGTGCTGAGGGCAGCTCGG + Intergenic
1017357423 6:153525984-153526006 ACGTAGTGAAGAGGACTGCTTGG - Intergenic
1017636928 6:156453137-156453159 AAGTGGGGATAAGGATTGTTTGG + Intergenic
1017942021 6:159061418-159061440 AAGTGCTGATGAGGACAACGGGG - Intergenic
1018057995 6:160068929-160068951 AATCAGTGCTGAGGACTGCTGGG + Intronic
1022373438 7:29791049-29791071 AGGTTGTAATGAGGACTGATTGG - Intergenic
1025072444 7:55912239-55912261 AAGTGTAGATGAGAACTACTGGG - Intronic
1025820115 7:64955172-64955194 AAGTGGGGAAGGGAACTGCTGGG + Intergenic
1025962915 7:66239601-66239623 ATGTGGAGATAATGACTGCTTGG + Intronic
1026034606 7:66822000-66822022 AAGTGGCGAGGAGATCTGCTGGG - Intergenic
1026844934 7:73693487-73693509 CAGTGGTGCAGAGGAGTGCTGGG + Intronic
1027492649 7:78848785-78848807 AGGTGGTGAGGAAGACTTCTAGG - Intronic
1028032909 7:85940317-85940339 AGGTGATGATGAGGACTGAAAGG - Intergenic
1029187728 7:98751787-98751809 AAGTGGTGATGAGCGGGGCTGGG + Intergenic
1030194205 7:106837048-106837070 AAGTTGTAATGGGGACTGATGGG - Intergenic
1031577861 7:123437846-123437868 AATTGGTGATAAGGAATTCTAGG - Intergenic
1031836414 7:126685712-126685734 AAGGGGTGCTGAGGACAGCGGGG + Intronic
1032050728 7:128648734-128648756 AAATTGTAATGAGGTCTGCTGGG - Intergenic
1032695224 7:134330182-134330204 GAGTGGTAATGAGGAGTGGTCGG + Intergenic
1033348784 7:140545228-140545250 AAGTGCTGCTCAGGCCTGCTGGG - Intronic
1033946007 7:146718430-146718452 ATGGGGTGCTAAGGACTGCTTGG + Intronic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1037004393 8:13759434-13759456 TGGTGGTGATCAGGGCTGCTGGG - Intergenic
1037765651 8:21770765-21770787 AAGTGGTGATGAAGAGGACTGGG - Intronic
1038132624 8:24750045-24750067 CATTGGTGATGAGGCCTGGTGGG - Intergenic
1040456739 8:47605702-47605724 GACTGGTGGTGAGGACTGATTGG + Intronic
1041314331 8:56545648-56545670 AACTGGTGATGAAAACTGATGGG + Intergenic
1042164578 8:65933296-65933318 AACTGGTGGAGAGGATTGCTGGG + Intergenic
1042952905 8:74219937-74219959 AAGTGGTGGTGGGGACTTCCTGG + Intergenic
1045902164 8:107295316-107295338 TAGTGGTGGTGGGGACTACTGGG - Intronic
1046395314 8:113632952-113632974 AGGTGGGGATGCGGACAGCTTGG - Intergenic
1046710162 8:117502249-117502271 GATTTGTGATGATGACTGCTTGG - Intergenic
1048910398 8:139129336-139129358 AAGTTGGGATGGGGACAGCTGGG - Intergenic
1049116686 8:140694847-140694869 AAGTGGTGATGGTGGCAGCTAGG - Intronic
1049647486 8:143742157-143742179 CAGTGGTGATGCGGACAGCTGGG - Intergenic
1050141926 9:2525030-2525052 AAGTGAGGATGAGACCTGCTGGG + Intergenic
1051719522 9:20021821-20021843 AGGAGGTGATGACGGCTGCTTGG - Intergenic
1053099155 9:35354870-35354892 AAGTGGTGTTGAGGACTTAAAGG - Intronic
1053619187 9:39798720-39798742 AAGTGGGGCTGAGGACAGCTTGG - Intergenic
1053877344 9:42558069-42558091 AAGTGGGGCTGAGGACAGCTTGG - Intergenic
1053895319 9:42736619-42736641 AAGTGGGGCTGAGGACAGCTTGG + Intergenic
1054234349 9:62543653-62543675 AAGTGGGGCTGAGGACAGCTTGG + Intergenic
1054264970 9:62908709-62908731 AAGTGGGGCTGAGGACAGCTTGG + Intergenic
1054922236 9:70554136-70554158 ATGTGCTAATGAGGCCTGCTTGG + Intronic
1057198682 9:93129127-93129149 AAGTGGGCATGAGGACAGCAGGG - Intronic
1057873138 9:98733042-98733064 GTGTGGTGATGAAGCCTGCTGGG - Exonic
1057945363 9:99323168-99323190 GAGGGGTCATGAGGACTGCTGGG + Intergenic
1058211840 9:102178269-102178291 AGGTGTTGATGAGGGCTGCTGGG + Intergenic
1058741089 9:107943246-107943268 AAGAGGTGATGAGGAAGGCGAGG + Intergenic
1059368428 9:113805590-113805612 AAGTGGATGTGAGGCCTGCTTGG - Intergenic
1059696665 9:116736419-116736441 AAGCAGTGATGAGGAGTGCTAGG - Intronic
1061074852 9:128334847-128334869 AGGTTGAGATGAAGACTGCTTGG - Intergenic
1061289767 9:129643949-129643971 ACGCTGTGATGTGGACTGCTGGG - Intergenic
1062727320 9:138083007-138083029 AGATGGTGATGGGGGCTGCTGGG - Intronic
1203576573 Un_KI270745v1:13471-13493 AAATTGTAATGAGGTCTGCTGGG - Intergenic
1203576969 Un_KI270745v1:16880-16902 AAACTGTGATGAGGTCTGCTGGG - Intergenic
1186753706 X:12648055-12648077 ATGTGGAGATCAGGAGTGCTTGG - Intronic
1187397543 X:18931408-18931430 AGGGGGTGATGGGGAGTGCTGGG + Intronic
1187621776 X:21063528-21063550 CAGTGGTGATGGGAACTGCTGGG + Intergenic
1188156551 X:26748901-26748923 ACGTGGTGAGGAAGACAGCTTGG - Intergenic
1188162782 X:26822644-26822666 AGGTGTTGATGTGGGCTGCTGGG + Intergenic
1192568573 X:72183642-72183664 AAGTGGTAATTTGGACTTCTTGG + Intronic
1194512396 X:94812236-94812258 TAGAAGTGATGAGGGCTGCTAGG - Intergenic
1194637005 X:96358279-96358301 ACATGGTGGTGAGGACTGATTGG + Intergenic
1195760884 X:108245218-108245240 GAGTGGTGAAGAAGACTTCTTGG - Intronic
1195831249 X:109061189-109061211 AAGTGGGAATGTGGACTGCTGGG + Intergenic
1196641541 X:118068542-118068564 AAGGGTTGATGGGGGCTGCTGGG - Intronic
1201233635 Y:11889854-11889876 AAGTTGTAATGGGGACTGATGGG + Intergenic