ID: 982352465

View in Genome Browser
Species Human (GRCh38)
Location 4:154430638-154430660
Sequence AATTCTAAGCATGAGTTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982352464_982352465 16 Left 982352464 4:154430599-154430621 CCTGTTCTCACAGCAAAAGTCTG 0: 1
1: 0
2: 1
3: 12
4: 186
Right 982352465 4:154430638-154430660 AATTCTAAGCATGAGTTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982352465 Original CRISPR AATTCTAAGCATGAGTTGTG TGG Intronic
No off target data available for this crispr