ID: 982356784

View in Genome Browser
Species Human (GRCh38)
Location 4:154478580-154478602
Sequence GACACAAGAACCTTAGCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982356781_982356784 21 Left 982356781 4:154478536-154478558 CCATGCAGGGTGGTTAGAGTCAC 0: 1
1: 0
2: 2
3: 14
4: 88
Right 982356784 4:154478580-154478602 GACACAAGAACCTTAGCATAGGG 0: 1
1: 0
2: 0
3: 14
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982356784 Original CRISPR GACACAAGAACCTTAGCATA GGG Intronic
901697403 1:11018862-11018884 GACGCAAGTACCTTAGAATTAGG - Exonic
901890449 1:12258972-12258994 GACACAGGAACCTTATGAGAAGG + Intronic
906775423 1:48525119-48525141 GGCCCAAGAGCCTTAGCATAAGG - Intergenic
908516706 1:64899821-64899843 GACACAAGAATCTTACAATATGG + Intronic
910245797 1:85136768-85136790 AACAAAAGGACCTTAGCTTAAGG - Intergenic
910732950 1:90419340-90419362 GACAAAAGAACATTCTCATATGG + Intergenic
918743156 1:188162594-188162616 GACAAAAGAAAATTTGCATATGG + Intergenic
922402796 1:225277208-225277230 CTCACAAGAACATTAGCATAGGG + Intronic
1065867813 10:29928850-29928872 GATACAAGAACCTTACAATGAGG - Intergenic
1072272782 10:93793576-93793598 TATTCAAGAAACTTAGCATAGGG + Intronic
1075257775 10:120939197-120939219 GTCACCAGAACCTTTGCAAAGGG + Intergenic
1078883921 11:15480908-15480930 GACAGATGAACTTTAGGATATGG - Intergenic
1079119971 11:17674996-17675018 CTCACAAGAACATTAGCTTAGGG + Intergenic
1080332160 11:31152189-31152211 GACACAAGAAGTTTGGAATAGGG + Intronic
1094549179 12:31434560-31434582 GACAAAAGGACCTTTGAATAAGG - Intronic
1095122438 12:38435477-38435499 GACACATGAACCTCTCCATAGGG + Intergenic
1095496904 12:42794670-42794692 GCCATAAGTAGCTTAGCATAGGG - Intergenic
1097710827 12:62915242-62915264 GACAAAAGAAACTTGGCTTAGGG + Intronic
1099217234 12:79867768-79867790 GTCACAAGAACAGAAGCATAGGG - Intronic
1103804431 12:123561296-123561318 GAAACAAGAAACTTAGCAACTGG + Intergenic
1104696014 12:130864328-130864350 GTCACAAGAACCTGTCCATAGGG + Intergenic
1106976573 13:35224887-35224909 CTCACAAAAGCCTTAGCATAAGG - Intronic
1109168783 13:59070117-59070139 TACAAAAGAACCTTATCATAAGG + Intergenic
1111196737 13:84884625-84884647 GACACAGGAACTTTAACAAATGG + Intergenic
1112140710 13:96638552-96638574 GTCACAAGAACAGCAGCATAGGG - Intronic
1113401998 13:110002724-110002746 GACAGAAGGGCCTTAGCGTATGG - Intergenic
1114826649 14:26088782-26088804 AAGACAAATACCTTAGCATAGGG + Intergenic
1115635447 14:35286480-35286502 GAAACAAGAAGCTGAGCATCGGG + Intronic
1117198110 14:53361636-53361658 GACACAAGGAGCATAGGATATGG - Intergenic
1120083275 14:80239334-80239356 GACATAAGAACATTTACATATGG + Intronic
1120399899 14:84017698-84017720 GGCATAAGAACCTTGGCATTTGG - Intergenic
1121150777 14:91631995-91632017 GAAAAAAGAACCTTAAAATAAGG + Intronic
1122100162 14:99402137-99402159 GACTGAAGACCTTTAGCATAGGG - Intronic
1122176349 14:99922611-99922633 GATACTAGAACCCTAGCACATGG - Intronic
1126332220 15:47545458-47545480 GATACAACAACCTTACCACAGGG + Intronic
1127665608 15:61143833-61143855 AAAACAATAATCTTAGCATAAGG + Intronic
1127992452 15:64130804-64130826 GACAGAAGACCCATAGCATGAGG + Intronic
1129203308 15:74019184-74019206 GACAAAAGAAGCTTAGAAAAAGG + Intronic
1130521676 15:84666391-84666413 GACACAACAGCCTAAGCCTAAGG + Intergenic
1133777561 16:8909357-8909379 CACCAAAGAACCTTGGCATATGG - Intronic
1137778924 16:51080232-51080254 GATACAACACCCTTAGTATAGGG - Intergenic
1141385774 16:83621156-83621178 GACAGAAGCAGCTTAGCAGAGGG - Intronic
1144304217 17:13952623-13952645 GAGCCAAGAACCTTGGCATAAGG + Intergenic
1145832429 17:27927517-27927539 CACACAAGAACCTTGCCACAAGG + Intergenic
1148839550 17:50486031-50486053 GGGACTAGAACCTTAGCCTAGGG + Intergenic
1148944963 17:51253355-51253377 GACACAAGAACCTATGTAGAAGG + Intronic
1149564198 17:57629963-57629985 GAGACAGGGGCCTTAGCATAGGG - Intronic
1151323588 17:73365834-73365856 GACACCAGAACCACAGCAGACGG + Intronic
1203172467 17_GL000205v2_random:161765-161787 GACAAAAGAATCTCAGCAGAGGG + Intergenic
1203173249 17_GL000205v2_random:171012-171034 GACAAAAGAATCTCAGCAGAGGG - Intergenic
1157446547 18:47750829-47750851 GACACTAGAAGCTTAGAATGAGG + Intergenic
1158878965 18:61758116-61758138 GTTACAAGAAAATTAGCATATGG + Intergenic
1160461109 18:79038987-79039009 TCCACAAGAACCTTAGCATGTGG - Intergenic
1160461175 18:79039657-79039679 CCCACGAGAACCTTAGCATAGGG - Intergenic
1160461202 18:79039907-79039929 TCCACGAGAACCTTAGCATAGGG - Intergenic
1161357084 19:3825219-3825241 GACACACGTACCCTCGCATAAGG + Exonic
1161698790 19:5784134-5784156 GCCACAAGAACCTTGCCATTGGG + Exonic
1161954313 19:7484470-7484492 GACACAAGAAGCTGACCACAGGG + Intronic
1167180081 19:47896462-47896484 GCCACAAGAATATTAGCATCTGG - Intergenic
926129126 2:10289989-10290011 GACACGCGAACCTTAGCCTACGG + Intergenic
927526774 2:23750445-23750467 GAGACAAGTACCTTAGCTTCAGG + Exonic
932476924 2:72012136-72012158 GACACAGGAACATTTGCTTATGG + Intergenic
940766076 2:157790884-157790906 AAGACAAACACCTTAGCATAAGG + Intronic
947377079 2:229506829-229506851 GACATCAGGACCATAGCATAGGG - Intronic
948511540 2:238468934-238468956 GATACAAGAAGCTGAGCAAATGG - Intergenic
948514923 2:238497918-238497940 GACACAGGCACCTTTGCACATGG + Intergenic
1169690655 20:8327285-8327307 CATACAAGTACTTTAGCATATGG - Intronic
1170248838 20:14256668-14256690 GACACAAGAAACTTTCCATTAGG - Intronic
1170477509 20:16730277-16730299 GACACAAGCACCTTCGCCCAAGG - Intronic
1172396358 20:34608864-34608886 GGTACAAGAAGCTTAGTATAAGG - Intronic
1175690500 20:61062393-61062415 GACACAAGAAGCTGTGCATGTGG - Intergenic
1176328461 21:5523555-5523577 GACAAAAGAATCTCAGCAGAGGG + Intergenic
1176329234 21:5532654-5532676 GACAAAAGAATCTCAGCAGAGGG - Intergenic
1176398523 21:6288297-6288319 GACAAAAGAATCTCAGCAGAGGG + Intergenic
1176399296 21:6297396-6297418 GACAAAAGAATCTCAGCAGAGGG - Intergenic
1176437861 21:6691708-6691730 GACAAAAGAATCTCAGCAGAGGG + Intergenic
1176438634 21:6700807-6700829 GACAAAAGAATCTCAGCAGAGGG - Intergenic
1176462123 21:7018778-7018800 GACAAAAGAATCTCAGCAGAGGG + Intergenic
1176462896 21:7027877-7027899 GACAAAAGAATCTCAGCAGAGGG - Intergenic
1176485684 21:7400556-7400578 GACAAAAGAATCTCAGCAGAGGG + Intergenic
1176486457 21:7409655-7409677 GACAAAAGAATCTCAGCAGAGGG - Intergenic
1183178588 22:36243331-36243353 GACAAAAGAACCTGAACAGAAGG - Intergenic
1185149620 22:49156555-49156577 AACACAAGAATCTTAGGGTAAGG - Intergenic
951245716 3:20339503-20339525 GACACAAATACATTTGCATATGG - Intergenic
951645484 3:24886039-24886061 GTCAGAAGAACCCTAGTATATGG - Intergenic
954712115 3:52510297-52510319 GACACAAGAACGTAGGCAGAGGG - Intronic
956891081 3:73614792-73614814 GACAAAAGCATCTGAGCATAGGG - Intronic
958068707 3:88580264-88580286 GACGTAACACCCTTAGCATAGGG - Intergenic
959022013 3:101197976-101197998 GACACAAGCACCATAACAGAGGG - Intergenic
959185369 3:103040117-103040139 GAAACAAAAACTTTAGCATTTGG - Intergenic
960430379 3:117561380-117561402 TAAACCAAAACCTTAGCATAAGG + Intergenic
961578177 3:127855615-127855637 GACAAAAGAGACTTAGCAAATGG - Intergenic
973823728 4:54684966-54684988 GACACTAGAACCTCAGGACAAGG - Intronic
973887783 4:55340233-55340255 GACTCAAGAACCTTAAAGTATGG + Intergenic
975919145 4:79362878-79362900 GTCACATGAATCTTAACATATGG - Intergenic
980617738 4:135253676-135253698 GACAGAAGAACATGAGCATAAGG - Intergenic
981506646 4:145508205-145508227 GACTGAAGAATCTTATCATATGG - Intronic
982356784 4:154478580-154478602 GACACAAGAACCTTAGCATAGGG + Intronic
985032922 4:185809771-185809793 GAGACAAGACCCTTAGCCCACGG - Intronic
987659817 5:20857533-20857555 GACACAAGAATATTAGAATTAGG + Intergenic
990370261 5:55110579-55110601 TACACAAGAACCTGAGTCTATGG + Intergenic
990746193 5:58961345-58961367 TACCCCAGAACCTTAGGATATGG - Intergenic
991244992 5:64501197-64501219 GACCAAAGAACTTTAGCATTGGG - Intergenic
995013444 5:107283832-107283854 TGGACAAGAACCTTAGCATTTGG + Intergenic
995368897 5:111396125-111396147 GAAAAAATAACCTTTGCATAAGG + Intronic
998474607 5:142409624-142409646 TACACAGGAACCTTAGCATGGGG + Intergenic
1003094078 6:3128837-3128859 GTCACAAAAACCTGAGCATACGG - Intronic
1009175401 6:60454349-60454371 GGCACAAGAAGCTTAGCTTTCGG + Intergenic
1016655842 6:146517469-146517491 GTCACAAGAACCTAAGAGTAGGG + Intergenic
1016713310 6:147197540-147197562 AAAACAAAAACCTTAACATAAGG - Intergenic
1017039994 6:150300430-150300452 GACACCAGACCCTTAGGATGTGG + Intergenic
1025859736 7:65315496-65315518 TAAACAAGCACCTTAGCAGAAGG + Intergenic
1027869061 7:83683251-83683273 AACACAAGAACCTTTGGATATGG + Intergenic
1036702244 8:11020426-11020448 GTCACAAGGAACTTAGCACAGGG - Intronic
1038417688 8:27409287-27409309 GAAACAAAAACCTTATCACAGGG + Intronic
1040738741 8:50545878-50545900 AACACAACAATCTTAGCAAATGG + Intronic
1043836799 8:85057102-85057124 AACAAAATAACCTTAGCATTTGG + Intergenic
1044417692 8:91954651-91954673 GACACCAGAGCGTTAGCACAGGG + Intergenic
1044957853 8:97500181-97500203 GACACAATAACATTAGCCTAGGG + Intergenic
1044980542 8:97712022-97712044 CAAACAAGAACCATAGCAAAAGG - Intronic
1048457937 8:134594832-134594854 GCTACAAGACCCTTAGCATCAGG + Intronic
1049973963 9:844400-844422 GAGAGAAGGTCCTTAGCATATGG + Intronic
1050444449 9:5703986-5704008 GAAACCAGAACCTTCACATATGG - Intronic
1059095985 9:111415342-111415364 GACACAAGAATCTGAGAAAATGG + Intronic
1203432863 Un_GL000195v1:107669-107691 GACAAAAGAATCTCAGCAGAGGG + Intergenic
1203433643 Un_GL000195v1:116913-116935 GACAAAAGAATCTCAGCAGAGGG - Intergenic
1195902380 X:109812570-109812592 GAAAAAACAACCTTAGCATCAGG + Intergenic
1196856899 X:119992707-119992729 GATACATAAACCTTAGCCTATGG + Intergenic
1199007234 X:142715104-142715126 AACACAATAAGCGTAGCATAAGG + Intergenic
1200827684 Y:7660584-7660606 CACACAAGATCCTAAGCTTATGG + Intergenic
1200954051 Y:8927678-8927700 CACACAAGATCCTAAGCTTATGG - Intergenic
1200986441 Y:9306582-9306604 CACACAAGATCCTAAGCTTATGG + Intergenic
1202124138 Y:21554320-21554342 CACACAAGATCCTAAGCTTATGG - Intergenic
1202154870 Y:21875060-21875082 CACACAAGATCCTAAGCTTATGG + Intergenic
1202232165 Y:22669061-22669083 CACACAAGAGCCTAAGCTTATGG - Intergenic
1202310991 Y:23527097-23527119 CACACAAGAGCCTAAGCTTATGG + Intergenic
1202559811 Y:26143497-26143519 CACACAAGAGCCTAAGCTTATGG - Intergenic