ID: 982358322

View in Genome Browser
Species Human (GRCh38)
Location 4:154492105-154492127
Sequence CGCAGGCGGGGCGTCTGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982358316_982358322 -2 Left 982358316 4:154492084-154492106 CCGCGGGGCGGGTGGGGGACGCG No data
Right 982358322 4:154492105-154492127 CGCAGGCGGGGCGTCTGCCTGGG 0: 1
1: 0
2: 1
3: 10
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982358322 Original CRISPR CGCAGGCGGGGCGTCTGCCT GGG Intergenic
901056008 1:6448888-6448910 CGCAGGCGGCGCTGCTTCCTGGG + Exonic
901696656 1:11012807-11012829 CGAAGCCGCTGCGTCTGCCTCGG - Intronic
902571335 1:17348828-17348850 CGCAGGCCTGGGGTCTTCCTGGG - Intronic
903103617 1:21053864-21053886 CGCAGACGGGGCGGCTGGCCGGG - Intronic
905364053 1:37439211-37439233 GGCATGTGGGGGGTCTGCCTGGG - Intergenic
905810904 1:40912457-40912479 AGCCGGCGGGGCATCAGCCTGGG - Intergenic
906140519 1:43531305-43531327 CGCTGGGGGCGCGTCTGCCGCGG - Intronic
907204824 1:52760207-52760229 CTCAGGCGGATCGCCTGCCTTGG - Intronic
907263571 1:53239933-53239955 CTCAGGCGATCCGTCTGCCTCGG + Intergenic
910673767 1:89797972-89797994 CTCAGACGGGGCGGCTGCCGGGG + Intronic
912844989 1:113069755-113069777 CCCAGACGGGGCGGCTGGCTGGG - Intergenic
915023653 1:152805527-152805549 GGCAGGGGTGGCCTCTGCCTAGG - Intronic
915531958 1:156507923-156507945 CCCAGGCTGGGCTTCTGCCAAGG + Intergenic
918255207 1:182741596-182741618 CCCAGACGGGGCGGCTGGCTGGG + Intergenic
921034315 1:211361928-211361950 CTCAGGCGATGCGCCTGCCTCGG + Intronic
921238023 1:213151619-213151641 CCCAGACGGGGCGGCTGGCTGGG + Intronic
922339168 1:224641629-224641651 TGCAGGTGTGGCCTCTGCCTAGG + Intronic
922456545 1:225778019-225778041 CGCTGGCGGGGCCGCTGCTTTGG + Intronic
1065336043 10:24656585-24656607 CCCAGACGGGGCGGCTGGCTGGG - Intronic
1065840442 10:29696935-29696957 CCCGGACGGGGCGTCTGGCTGGG - Intronic
1067015222 10:42753290-42753312 CGCCGGCGGCGCCTTTGCCTGGG - Intergenic
1068043898 10:51861838-51861860 GGCAGGTGGTGCCTCTGCCTGGG + Intronic
1072013357 10:91323235-91323257 CCCAGACGGGGCGGCTGGCTGGG + Intergenic
1072294302 10:93994326-93994348 CTTAGGCGGGTCGACTGCCTTGG - Intronic
1073123420 10:101135349-101135371 CGAAGGCGAGGAATCTGCCTGGG + Intronic
1077013560 11:390505-390527 GGCAGGCGGGGCATCTCCCGGGG - Intergenic
1077013590 11:390590-390612 GGCAGGCGGGGCATCTCCCGGGG - Intergenic
1077013620 11:390675-390697 GGCAGGCGGGGCATCTCCCGGGG - Intergenic
1077013650 11:390760-390782 GGCAGGCGGGGCATCTCCCGGGG - Intergenic
1077013680 11:390845-390867 GGCAGGCGGGGCATCTCCCGGGG - Intergenic
1077013710 11:390930-390952 GGCAGGCGGGGCATCTCCCGGGG - Intergenic
1077877242 11:6319268-6319290 CGCAGGCTGGGCTTCCGGCTGGG + Exonic
1079248604 11:18771374-18771396 CTCAGGCGGTGCGTCTTCCACGG + Intronic
1081018230 11:37908726-37908748 CTCTGGCGGGACATCTGCCTTGG + Intergenic
1083748104 11:64746130-64746152 CGGGGGCGGGGCGTCTGCCTGGG - Intergenic
1083832164 11:65239697-65239719 CCCAGACGGGGCGGCTGGCTGGG - Intergenic
1084003804 11:66313018-66313040 CGCAGGCCGGGGCTCTGCCCTGG + Intergenic
1084112913 11:67024967-67024989 CCCAGGAGGGGCCTCTGCCATGG + Intronic
1084527231 11:69704767-69704789 CGCAGCCTCGGCGTCCGCCTGGG + Intergenic
1084924700 11:72502464-72502486 CCCAGACGGGGCGGCTGGCTGGG + Intergenic
1086122511 11:83316754-83316776 CCCAGGCGGGGCGGCTGGCCGGG + Intergenic
1089148446 11:116347109-116347131 CTCAGACGGGGCGGCTGCCCGGG - Intergenic
1089256559 11:117197262-117197284 CTCAGGCGGGGCCTCTGCTTTGG + Exonic
1089549512 11:119261145-119261167 CTCAGGTGAGCCGTCTGCCTTGG + Intronic
1091308845 11:134558876-134558898 CACAGGCAGGGCGTCTGCACCGG + Intergenic
1091328850 11:134714484-134714506 CGCAGGCCAGGGCTCTGCCTGGG + Intergenic
1091798357 12:3309829-3309851 GGCAAGCGGGGCCTTTGCCTGGG - Intergenic
1095953635 12:47794899-47794921 CGCAGCCGGGGCTTCTCACTCGG + Exonic
1096041399 12:48520496-48520518 CCCAGACGGGGCGGCTGGCTGGG + Intronic
1096318506 12:50590230-50590252 CTCAGGCGAGCCTTCTGCCTTGG + Intronic
1097018910 12:56006557-56006579 CTCAGGCAGTACGTCTGCCTCGG + Intronic
1097149203 12:56963869-56963891 CCCAGACGGGGCGGCTGGCTGGG - Intergenic
1097525797 12:60733896-60733918 CTCAGGCGATCCGTCTGCCTTGG + Intergenic
1102323380 12:111957550-111957572 CCCAGACGGGGCGGCTGGCTGGG - Intronic
1103641866 12:122357833-122357855 CCCAGGCGGGGCGGCTGGCCGGG - Intronic
1106127088 13:26909433-26909455 CCCAGGCAGGGCTTCTCCCTGGG - Intergenic
1106169031 13:27272831-27272853 CTCAGGCAGGGAGTTTGCCTGGG + Intronic
1106296112 13:28415244-28415266 CTCAGGTGGTCCGTCTGCCTTGG - Intronic
1110101674 13:71613918-71613940 CCCAGGCTGGGCTCCTGCCTTGG + Intronic
1119835761 14:77747721-77747743 CCCAGACGGGGCGGCTGCCGGGG - Intronic
1124043641 15:26127789-26127811 AGCAGGCAGGGCAGCTGCCTTGG - Intergenic
1125052669 15:35319505-35319527 CTCAGGCGATCCGTCTGCCTCGG - Intronic
1125659391 15:41383025-41383047 CCCAGACGGGGCGGCTGGCTGGG - Intergenic
1125862933 15:43014990-43015012 CCCAGTCGGGGCGTCTGGCCGGG - Intronic
1126090588 15:45047843-45047865 CTCAGGCAGGGGGTCTGCCAGGG + Intronic
1126484021 15:49159340-49159362 CTCAGGTGGTCCGTCTGCCTCGG - Intronic
1127154174 15:56110060-56110082 CCCAGACGGGGCGGCTGGCTGGG - Intronic
1132502838 16:292210-292232 CGGAGCCGGGGCGTGTGACTGGG - Intronic
1134058311 16:11183585-11183607 CCCAGGCCGTGCGCCTGCCTTGG + Intergenic
1134117474 16:11560061-11560083 CTCAGGCGATCCGTCTGCCTTGG - Intronic
1136910439 16:34140875-34140897 AGCAGGCCTGGCGTCTGCCCGGG + Intergenic
1137248909 16:46728993-46729015 CAGAGGCGGGGCGGCCGCCTCGG - Intronic
1137430792 16:48416745-48416767 CCCAGACGGGGCGGCTGCCGGGG + Intronic
1139623113 16:68163337-68163359 CCCGGGCGGGGCGGCTGGCTGGG + Intronic
1142371746 16:89686492-89686514 CGCAGCCGGGTCGGCTGCCCGGG + Exonic
1144038273 17:11386699-11386721 CTCAGGCGGGGCGCTGGCCTTGG + Intronic
1145222433 17:21100374-21100396 CTCAGGTGAGCCGTCTGCCTCGG + Intergenic
1145884223 17:28371558-28371580 CAGAGGCGGGGCGTCGGCCCGGG + Intronic
1145884252 17:28371636-28371658 CAGAGGCGGGGCGTCGGCCGGGG + Intronic
1146372665 17:32275243-32275265 CCCAGGCGGCGCGTCAGGCTGGG + Intronic
1146403631 17:32519343-32519365 CGCAGGAAGGGCGGCTGCCGGGG + Intronic
1146708187 17:35017505-35017527 CCCAGGTGGGGCCTCTGCTTGGG - Exonic
1146943361 17:36858967-36858989 CGCAGGCGTGCCCTCTCCCTGGG + Intergenic
1147871635 17:43591764-43591786 CGCAGGAGCAGCGGCTGCCTGGG + Intergenic
1149592970 17:57846129-57846151 CCCAGACGGGGCGGCTGGCTGGG - Intronic
1150527427 17:65937762-65937784 CCCAGACGGGGCGGCTGGCTGGG - Intronic
1150675879 17:67245481-67245503 CAGACGCGGGGCGTCTGCCCGGG - Intronic
1151625097 17:75271322-75271344 CGCAGGCGGCGCGGCTTCCGGGG - Intergenic
1151838778 17:76602346-76602368 CTCAGGCGGTCCGCCTGCCTTGG - Intergenic
1152606606 17:81294759-81294781 CGCAGAGGGGGCGTCTGGCTGGG - Intronic
1152744375 17:82032137-82032159 CGGAGTCGGGGCCTCTGCCTGGG + Intronic
1152889273 17:82871118-82871140 GGCGGGCGGGGCTCCTGCCTCGG + Intronic
1155322430 18:24632314-24632336 CGCAGGTGGGGAGTCTCCCTTGG + Intergenic
1160465032 18:79069308-79069330 CGCAGGCGGCGCCTCAGCCGGGG + Intronic
1161010038 19:1955525-1955547 CGCGGGGTGGGCGTGTGCCTGGG + Intronic
1161332743 19:3696133-3696155 GGCAGGCGGGGCCTCTGCTGGGG + Intronic
1161443454 19:4305083-4305105 AGCTGGCGGGGCGTCTTCCAGGG - Intronic
1162940705 19:14007136-14007158 CGCAGGCGGTGCGGCCGCCTTGG + Intergenic
1163558471 19:18005737-18005759 CCCAGACGGGGCGACTGGCTTGG + Intronic
1163777113 19:19225147-19225169 CGCCGGCGCGGCGTCTGGATCGG - Exonic
1165809476 19:38602306-38602328 CTCAGGTGATGCGTCTGCCTTGG + Intronic
1167532154 19:50024920-50024942 CGCAGGTGGGGCGATTGCCTAGG + Intronic
1167725121 19:51206579-51206601 CTCAGGCGATCCGTCTGCCTTGG + Intergenic
929066062 2:37977438-37977460 CCCAGACGGGGCGGCTGGCTGGG + Intronic
929173972 2:38958976-38958998 CTCAGGCGATCCGTCTGCCTCGG + Intronic
930016661 2:46975392-46975414 GGCAGGGGTGGAGTCTGCCTGGG + Intronic
931805382 2:65798775-65798797 CGCAGGCGCGGTGTCAGGCTGGG + Intergenic
932032799 2:68207920-68207942 CCCAGGCGAGCCGCCTGCCTCGG - Intronic
932807307 2:74795688-74795710 CCCAGACGGGGCGGCTGGCTGGG + Intergenic
932812180 2:74834653-74834675 CGCGGGCGGGGCGGCAGGCTGGG + Intronic
934762076 2:96861912-96861934 CGCAGGAGGGGGGTCGGCCAGGG + Intronic
935643062 2:105308898-105308920 CCAAGGCCTGGCGTCTGCCTCGG - Intronic
937322395 2:120968731-120968753 CTCAGGCGGGGCGTCACCCGCGG - Exonic
937381735 2:121383456-121383478 CTCAGGCTGGGCCTCTGCTTGGG + Intronic
938534118 2:132221886-132221908 CCCAGACGGGGCGGCTGGCTGGG - Intronic
938798787 2:134740896-134740918 CTCAGGCGATCCGTCTGCCTTGG - Intergenic
939584715 2:143991656-143991678 CCCAGACGGGGCGGCTGGCTGGG - Intronic
941793274 2:169575258-169575280 CCCGGGCGGGGCGGCTGGCTGGG + Intergenic
944672025 2:202002861-202002883 CTCAGGCGATCCGTCTGCCTCGG - Intergenic
944889263 2:204100078-204100100 CTCAGGTGGGCCGCCTGCCTCGG + Intergenic
1170424842 20:16227444-16227466 CCCAGACGGGGCGTCTGGCCGGG + Intergenic
1171850504 20:30304615-30304637 CACAGGCGGGGGGTCTTTCTCGG - Intergenic
1175396711 20:58669352-58669374 AGCAGGAGGGGCGGCTGCTTGGG + Exonic
1176169038 20:63688882-63688904 AGCAGGCGTGGGGTCAGCCTGGG + Intronic
1179506781 21:41846468-41846490 CTCAAGCGGTCCGTCTGCCTCGG - Intronic
1181538680 22:23561273-23561295 CCCAGACGGGGCGGCTGGCTGGG + Intergenic
1181573696 22:23781188-23781210 ATCTGGCGGGGCGTCTGGCTGGG - Exonic
1181740964 22:24921331-24921353 CTCAGGCGATCCGTCTGCCTTGG + Intronic
1183873793 22:40761589-40761611 CTCAGGCGGTCCTTCTGCCTTGG + Intergenic
1184659437 22:45959159-45959181 CACAGGCGGGGCCTCTGTCGGGG - Intronic
1185153868 22:49181814-49181836 CTCAGGTGGTGCTTCTGCCTCGG - Intergenic
1185355256 22:50365302-50365324 CTCAGGCGATGCATCTGCCTCGG + Intronic
950297287 3:11842917-11842939 TGCAGGCTGGGGTTCTGCCTAGG + Intronic
950507013 3:13401300-13401322 AGAAGGCGGGACATCTGCCTAGG - Intronic
954395101 3:50289343-50289365 GGCAGCCGGGGCAGCTGCCTAGG + Exonic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
960029918 3:113046291-113046313 CCCAGACGGGGCGGCTGGCTGGG + Intergenic
960577516 3:119242761-119242783 CCCGGGCGGGGCGGCTGGCTGGG - Intergenic
961784098 3:129339059-129339081 CCCGGGCGGGGCGGCTGGCTGGG + Intergenic
963248923 3:143086393-143086415 CCCAGACGGGGCGGCTGGCTGGG + Intergenic
963248973 3:143086520-143086542 CCCAGACGGGGCGGCTGGCTGGG + Intergenic
964451511 3:156817062-156817084 CGCAGGCGGCGCGGCGGCCTGGG + Intergenic
966886568 3:184380489-184380511 CGCGGGCGGGGAGTCGGGCTCGG + Intronic
968137362 3:196228740-196228762 AGGAGCCGGGGCGTCTTCCTGGG + Intronic
968870787 4:3241084-3241106 CCCTGGGGTGGCGTCTGCCTAGG + Exonic
968910512 4:3475061-3475083 AGCAGGAGGGGCTGCTGCCTTGG - Intronic
975116628 4:70687948-70687970 CGCAGGCCGGGCCTCCGGCTCGG - Intergenic
977205176 4:94158241-94158263 CCCGGGCGGGGCGGCTGGCTGGG - Intergenic
979644567 4:123053311-123053333 CGCAGCCGGAGTATCTGCCTTGG - Intronic
982182820 4:152765270-152765292 CCCAGACGGGGCGGCTGGCTGGG + Intronic
982358322 4:154492105-154492127 CGCAGGCGGGGCGTCTGCCTGGG + Intergenic
982518989 4:156389414-156389436 CTCAGGTGATGCGTCTGCCTCGG + Intergenic
984995560 4:185426796-185426818 CGCAGGTGATGCGTCTGCCTTGG - Intronic
985657603 5:1140237-1140259 CTCAGGAGGGGGATCTGCCTGGG - Intergenic
988564840 5:32312721-32312743 CGCAGGCGGGGCGTCGGGCAGGG - Intronic
991073621 5:62513331-62513353 CCCAGACGGGGCGGCTGGCTGGG + Intronic
994907489 5:105859562-105859584 CCCAGACGGGGCGGCTGGCTGGG - Intergenic
995241023 5:109885329-109885351 CGCAGCCGAGGCGCCGGCCTGGG - Intergenic
997874751 5:137537771-137537793 CCCAGACGGGGCGGCTGGCTGGG + Intronic
997874879 5:137538077-137538099 CCCAGACGGGGCGGCTGGCTGGG + Intronic
1001626740 5:173142649-173142671 CACAGGCTTGGCATCTGCCTGGG - Intergenic
1002061819 5:176629871-176629893 CGCGGGAGGGGCCACTGCCTCGG + Exonic
1003263501 6:4546512-4546534 GGCAGGCAGGGCCTTTGCCTCGG + Intergenic
1003529440 6:6925618-6925640 CGTGGGCTGGGCGACTGCCTGGG - Intergenic
1003942524 6:11043878-11043900 CGAAGGAGGGGCGGCTTCCTCGG + Intronic
1005606914 6:27485331-27485353 CCCAGACGGGGCGGCTGGCTGGG + Intergenic
1016386757 6:143537070-143537092 CGCCGGCGGGGCGGGCGCCTCGG - Intronic
1016958394 6:149648717-149648739 CGCACGCGGGGCGTCGCCCCGGG + Exonic
1017843834 6:158240442-158240464 CCCAGACGGGGCGGCTGGCTGGG + Intronic
1019669216 7:2268616-2268638 CCCAGACGGGGCGGCTGGCTGGG - Intronic
1019674616 7:2303349-2303371 CCCAGACGGGGCGGCTGGCTGGG - Intronic
1021672287 7:23046121-23046143 CCCAGACGGGGCGGCTGGCTGGG + Intergenic
1021845282 7:24757416-24757438 CGCAGGGGGCGCGGCTGCCGGGG - Intronic
1024452454 7:49563583-49563605 AGCTGACGGGGCATCTGCCTGGG + Intergenic
1024593479 7:50911770-50911792 CTCAGGTGGTCCGTCTGCCTCGG - Intergenic
1025739475 7:64183695-64183717 CCCAGGAGGGGGGTCAGCCTGGG + Intronic
1025821410 7:64967761-64967783 CCCGGACGGGGCGTCTGGCTGGG + Intergenic
1025821483 7:64967937-64967959 CCCGGACGGGGCGTCTGGCTGGG + Intergenic
1026822132 7:73557133-73557155 CGCAGGCGGGGCCACTGCCCAGG + Intronic
1027371348 7:77509846-77509868 CCCAGACGGGGCGGCTGGCTGGG - Intergenic
1033379662 7:140802529-140802551 CTCAGGTGATGCGTCTGCCTAGG + Intronic
1034110997 7:148537421-148537443 TGCAGGCTGGGCCTCTTCCTTGG - Intergenic
1034497558 7:151431664-151431686 CGCAGGAGAGGGGTCTGCCCTGG + Intronic
1035640905 8:1184602-1184624 CCCAGGCTCGGCATCTGCCTGGG - Intergenic
1035818005 8:2561851-2561873 CGGAGGCGGGGCTTGAGCCTTGG + Intergenic
1038828578 8:31033256-31033278 CGCAGGAGGGGCGGCTGCGGTGG - Exonic
1042743326 8:72075678-72075700 CGGCGGCGCCGCGTCTGCCTTGG + Intronic
1053018627 9:34678861-34678883 CTCAGGCGATCCGTCTGCCTTGG + Intergenic
1055414140 9:76064105-76064127 CCCAGACGGGGCGGCTGGCTGGG + Intronic
1056152710 9:83804542-83804564 CCCGGACGGGGCGTCTGGCTGGG - Intronic
1056963583 9:91147507-91147529 CTCAGGAGGGGCCTTTGCCTGGG - Intergenic
1057921936 9:99104982-99105004 CGCAGGCGGGGCTCCCGGCTGGG + Intronic
1060334801 9:122711411-122711433 CCCAGACGGGGCGGCTGGCTGGG - Intergenic
1060682397 9:125577454-125577476 CCCAGACGGGGCGGCTGGCTGGG - Intronic
1061831688 9:133300227-133300249 CCCAGACGGGGCGGCTGGCTGGG - Intergenic
1062206650 9:135341341-135341363 CGCAGCCGGCGCGTCTCCCGTGG - Intergenic
1203405590 Un_KI270539v1:391-413 CCCAGACGGGGCGTCTGGCCGGG - Intergenic
1186430245 X:9498920-9498942 AGCAAGGGGGGCGTCTCCCTGGG - Intronic
1188451219 X:30309434-30309456 CGCAGGCGCGTCGGCCGCCTCGG + Exonic
1196324577 X:114388380-114388402 CTCAGGCGATGCATCTGCCTTGG + Intergenic
1200209696 X:154341755-154341777 CGCTGCCGGGGCGTCGGCCGTGG - Intergenic
1200221156 X:154390337-154390359 CGCTGCCGGGGCGTCGGCCGTGG + Intronic