ID: 982358322

View in Genome Browser
Species Human (GRCh38)
Location 4:154492105-154492127
Sequence CGCAGGCGGGGCGTCTGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982358316_982358322 -2 Left 982358316 4:154492084-154492106 CCGCGGGGCGGGTGGGGGACGCG No data
Right 982358322 4:154492105-154492127 CGCAGGCGGGGCGTCTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982358322 Original CRISPR CGCAGGCGGGGCGTCTGCCT GGG Intergenic