ID: 982359359

View in Genome Browser
Species Human (GRCh38)
Location 4:154502947-154502969
Sequence TAGTGGCCCTAAAGGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982359355_982359359 23 Left 982359355 4:154502901-154502923 CCAAATAAGGATTTTGAAGAAAA No data
Right 982359359 4:154502947-154502969 TAGTGGCCCTAAAGGGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982359359 Original CRISPR TAGTGGCCCTAAAGGGAAAT AGG Intergenic
No off target data available for this crispr