ID: 982361502

View in Genome Browser
Species Human (GRCh38)
Location 4:154524020-154524042
Sequence GCTGGAGCCCAGATGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 506
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 456}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982361497_982361502 -2 Left 982361497 4:154523999-154524021 CCCAAAGAAGGCTTCTGCTCTGC 0: 1
1: 0
2: 3
3: 12
4: 225
Right 982361502 4:154524020-154524042 GCTGGAGCCCAGATGGAGGCTGG 0: 1
1: 0
2: 2
3: 47
4: 456
982361498_982361502 -3 Left 982361498 4:154524000-154524022 CCAAAGAAGGCTTCTGCTCTGCT 0: 1
1: 0
2: 2
3: 25
4: 251
Right 982361502 4:154524020-154524042 GCTGGAGCCCAGATGGAGGCTGG 0: 1
1: 0
2: 2
3: 47
4: 456
982361495_982361502 0 Left 982361495 4:154523997-154524019 CCCCCAAAGAAGGCTTCTGCTCT 0: 1
1: 0
2: 2
3: 21
4: 201
Right 982361502 4:154524020-154524042 GCTGGAGCCCAGATGGAGGCTGG 0: 1
1: 0
2: 2
3: 47
4: 456
982361488_982361502 29 Left 982361488 4:154523968-154523990 CCTCTGCCTTTTTAAGGACCCCT 0: 1
1: 1
2: 1
3: 19
4: 184
Right 982361502 4:154524020-154524042 GCTGGAGCCCAGATGGAGGCTGG 0: 1
1: 0
2: 2
3: 47
4: 456
982361490_982361502 11 Left 982361490 4:154523986-154524008 CCCCTGTGCCACCCCCAAAGAAG 0: 1
1: 0
2: 4
3: 22
4: 308
Right 982361502 4:154524020-154524042 GCTGGAGCCCAGATGGAGGCTGG 0: 1
1: 0
2: 2
3: 47
4: 456
982361491_982361502 10 Left 982361491 4:154523987-154524009 CCCTGTGCCACCCCCAAAGAAGG 0: 1
1: 0
2: 3
3: 21
4: 216
Right 982361502 4:154524020-154524042 GCTGGAGCCCAGATGGAGGCTGG 0: 1
1: 0
2: 2
3: 47
4: 456
982361496_982361502 -1 Left 982361496 4:154523998-154524020 CCCCAAAGAAGGCTTCTGCTCTG 0: 1
1: 0
2: 1
3: 21
4: 213
Right 982361502 4:154524020-154524042 GCTGGAGCCCAGATGGAGGCTGG 0: 1
1: 0
2: 2
3: 47
4: 456
982361493_982361502 9 Left 982361493 4:154523988-154524010 CCTGTGCCACCCCCAAAGAAGGC 0: 1
1: 0
2: 1
3: 30
4: 190
Right 982361502 4:154524020-154524042 GCTGGAGCCCAGATGGAGGCTGG 0: 1
1: 0
2: 2
3: 47
4: 456
982361487_982361502 30 Left 982361487 4:154523967-154523989 CCCTCTGCCTTTTTAAGGACCCC 0: 1
1: 1
2: 0
3: 24
4: 164
Right 982361502 4:154524020-154524042 GCTGGAGCCCAGATGGAGGCTGG 0: 1
1: 0
2: 2
3: 47
4: 456
982361489_982361502 23 Left 982361489 4:154523974-154523996 CCTTTTTAAGGACCCCTGTGCCA 0: 1
1: 0
2: 0
3: 10
4: 151
Right 982361502 4:154524020-154524042 GCTGGAGCCCAGATGGAGGCTGG 0: 1
1: 0
2: 2
3: 47
4: 456
982361494_982361502 3 Left 982361494 4:154523994-154524016 CCACCCCCAAAGAAGGCTTCTGC 0: 1
1: 3
2: 5
3: 41
4: 275
Right 982361502 4:154524020-154524042 GCTGGAGCCCAGATGGAGGCTGG 0: 1
1: 0
2: 2
3: 47
4: 456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982361502 Original CRISPR GCTGGAGCCCAGATGGAGGC TGG Intergenic
900120964 1:1048461-1048483 GCAGGAGCCCGGATTAAGGCGGG + Intronic
900506906 1:3033948-3033970 GCTGCAGCACAGATGGAGGATGG + Intergenic
900584152 1:3424492-3424514 CGTGGAGGCCAGATGGAGGAAGG + Intronic
900921906 1:5678081-5678103 GCTGGAGCCCAGAGGAAGTCAGG + Intergenic
902388511 1:16089354-16089376 GCTGGAGGCTAGAGGGAGGTGGG + Intergenic
902614982 1:17618780-17618802 GCTGGACCTCAGACGGAGGACGG - Intronic
903186464 1:21632079-21632101 GCTGGAGCCAACCTGGAGTCTGG + Intronic
903745908 1:25586419-25586441 GCTGTGGCCCTGATGGACGCTGG - Intergenic
903768096 1:25747527-25747549 CCCGGAGCCCACATGGAGCCTGG - Intronic
904036150 1:27559815-27559837 ACTGGAGCCCAGAGGGGGTCTGG + Intronic
904461704 1:30684608-30684630 ACTGAGGCCCAGATTGAGGCAGG - Intergenic
904888217 1:33757945-33757967 CCTGGAGCCGATATGGAGGATGG - Intronic
904969663 1:34409228-34409250 GCTGGAGGACTGATGGAGGGGGG + Intergenic
905391629 1:37639460-37639482 GCTGAAGCCCCAGTGGAGGCTGG - Intergenic
908794334 1:67816451-67816473 ACAGGAGTCCAGATGAAGGCAGG - Intronic
912501582 1:110126189-110126211 GTTGGAGGACAGAAGGAGGCAGG + Intergenic
912530125 1:110314542-110314564 CCTGGAGCCCAGACGGAGGATGG + Intergenic
912652023 1:111448675-111448697 GCCGGAGTCCAAACGGAGGCTGG - Exonic
912924928 1:113905379-113905401 GCTGGAGCCCAAATCGCGGAGGG - Exonic
915033083 1:152900980-152901002 TCTGGAGCCAATAAGGAGGCTGG - Intergenic
915245506 1:154553413-154553435 GCTGCAGCTGAGATCGAGGCAGG + Intronic
917130653 1:171739127-171739149 GATAGATTCCAGATGGAGGCTGG + Intronic
919880892 1:201899822-201899844 GTTGGAGTCCAGGTTGAGGCTGG + Exonic
920053313 1:203176034-203176056 GCTGGTGCCCAGCTGGGGGAGGG + Intergenic
920371219 1:205480659-205480681 GCTGGAGGCCGCATGGAGGATGG + Intergenic
920577190 1:207070232-207070254 GCAGGAGCCCAGGTGCAAGCTGG - Intronic
920627143 1:207613229-207613251 GGTGGACCCCAGATGAAGTCAGG + Intronic
920637091 1:207714164-207714186 GGTGGACCCCAGATGAAGTCAGG + Intronic
921214375 1:212924689-212924711 GCTAGAGGCCAGGTGGAGGAAGG - Intergenic
922127618 1:222743902-222743924 GCTGAAGCCGAGATGGTTGCTGG - Intronic
922786073 1:228282917-228282939 GCTGTAGCCCAGATGGTGGCTGG + Intronic
922869024 1:228884955-228884977 CCTGGGGCACAGATTGAGGCAGG - Intergenic
924944641 1:248838227-248838249 GCTGGAGCCGGGAAGCAGGCGGG - Intronic
1063450150 10:6145446-6145468 GCTGGAGCGCAGCGGGAAGCGGG - Intronic
1063993630 10:11594930-11594952 GATGGGTCCCAGAAGGAGGCAGG + Intronic
1064011631 10:11741090-11741112 GCTGGAGGTCAGATGAAGGATGG - Intergenic
1064049961 10:12051604-12051626 GCAGGAACCCGGATGGGGGCTGG - Intergenic
1064414559 10:15137255-15137277 TCTGAAGTCCAGCTGGAGGCAGG + Intronic
1065767064 10:29040065-29040087 GATGGAGCCCAGCTGGTGCCTGG - Intergenic
1067097786 10:43313930-43313952 GCTAGAGCCTAGAAGGTGGCAGG - Intergenic
1067139896 10:43648438-43648460 GCTGAAGCCCGCACGGAGGCCGG + Intronic
1067795701 10:49320230-49320252 GCTGGAGCCCAGTCAGAGACTGG + Intronic
1068285584 10:54930039-54930061 GCTGGAGCACAGGTGAATGCTGG + Intronic
1068327881 10:55518519-55518541 GCTGGGGCACAGAGGGAGGTTGG + Intronic
1068492122 10:57737560-57737582 GATGGAGCCCTGAAGGTGGCTGG - Intergenic
1069841149 10:71340176-71340198 GCTGGAACGCAGGTGGATGCAGG - Intronic
1070570088 10:77634554-77634576 GCTGGAGTCCAGAGGAAAGCAGG - Intronic
1070699316 10:78588182-78588204 TTTGGAGCCCAGAGGGAGCCAGG + Intergenic
1070788962 10:79178491-79178513 GCTGGAGCCCAGCTGGGCGGGGG + Intronic
1071143501 10:82540579-82540601 GTTGGAGCCCAGGTGGAGTAAGG + Intronic
1071504172 10:86222789-86222811 CCTGGAGCCCAGCTGAAGGGGGG + Intronic
1071874512 10:89830098-89830120 GCTGGAGTCAAGACAGAGGCAGG - Intergenic
1072501302 10:96020593-96020615 ACAGGAGCCCAGAGGGAGGGAGG + Intronic
1072757061 10:98028638-98028660 GGTGCAGCCCAGATGGAGAAGGG + Intronic
1073178753 10:101571322-101571344 GCTACAGCCCTGCTGGAGGCAGG - Intronic
1074445032 10:113514525-113514547 TCAAGACCCCAGATGGAGGCTGG - Intergenic
1074744206 10:116515149-116515171 ACTGGAGCCCAGCTGGAGAAGGG + Intergenic
1074882058 10:117667222-117667244 GCTGAAGCCCAGAGAGAGGTTGG + Intergenic
1075190463 10:120302547-120302569 GATGGAGCCCAGAGGCTGGCAGG + Intergenic
1075206821 10:120456242-120456264 GCTGGAGCCCAGCAGGAGCTTGG - Intergenic
1075574486 10:123568939-123568961 GCTGGAGGCCAGGAGGAGGGAGG + Intergenic
1076107338 10:127834243-127834265 GCTGGAGGGCAGATAGATGCTGG - Intergenic
1076116858 10:127907068-127907090 GCTGGAGCCGAGGCGGCGGCGGG + Exonic
1076250249 10:128979318-128979340 GCAGGAGCCCACATGGAGTGTGG - Intergenic
1076296299 10:129387464-129387486 ACTGCAGCCCAGAGGCAGGCAGG - Intergenic
1076358306 10:129868755-129868777 GCTGCAGGCCTGGTGGAGGCCGG + Intronic
1076627509 10:131831097-131831119 GCAGGAGCCAAGCTGGAGGACGG + Intergenic
1076906547 10:133365180-133365202 CCAGGTGCGCAGATGGAGGCAGG + Intronic
1076930224 10:133527449-133527471 GCTGGTGTCCATGTGGAGGCAGG + Exonic
1076934513 10:133558524-133558546 GCATGTGACCAGATGGAGGCAGG + Intronic
1077113645 11:873086-873108 GCTGGAGCCCAGGTGCTGGGTGG + Intronic
1077213014 11:1382218-1382240 ACAGGAGCTCAGATGGAGACAGG + Intergenic
1077315368 11:1917308-1917330 GGTGGCCCCCAGATGGTGGCCGG - Intergenic
1077317321 11:1925324-1925346 GCTGGAGCCCATGTGGGGGTGGG + Intronic
1077474227 11:2778845-2778867 GCTGCAGCCGAGATGGAAGCAGG - Intronic
1077474379 11:2779453-2779475 GCTGCAGCCGAGATGGAAGCAGG - Intronic
1077483668 11:2828469-2828491 GCAGGAGGACAGATGGAGACTGG + Intronic
1077841686 11:5982518-5982540 GCTGGGACCCAGAAAGAGGCTGG + Intergenic
1080418850 11:32092686-32092708 GCCTGGTCCCAGATGGAGGCAGG + Intronic
1081617227 11:44598033-44598055 ACTGGAAGCCAGATGGTGGCAGG - Intronic
1081856247 11:46305513-46305535 GCTGCAGGCAAGATGGAGGCAGG - Intronic
1081976890 11:47241099-47241121 GCAGGAGACCAGATGGAGTAGGG + Intronic
1083325173 11:61869440-61869462 ACTGGAGGCCAGATGGACGCTGG + Intergenic
1083405587 11:62454814-62454836 GCTGGAGCAGACATGGGGGCAGG - Intronic
1083671256 11:64300966-64300988 ACTGCATCCCAGATCGAGGCCGG + Exonic
1083899852 11:65638309-65638331 GCTGGAGCCCGGAGGGAAGTTGG - Intronic
1083955583 11:65981240-65981262 GCTAGAGCCCAGGTGGAGCCAGG + Intergenic
1084274610 11:68044946-68044968 CCTGGCACCCAGATGGAGGAGGG + Exonic
1084526347 11:69700786-69700808 GCCGGCGCCCAGCTGGTGGCCGG + Intronic
1084569126 11:69949066-69949088 GCTGGAGCCAGGCTGGAGGAAGG + Intergenic
1084598704 11:70132405-70132427 GCTGCAGCAGGGATGGAGGCAGG - Intronic
1085051862 11:73384084-73384106 GCTGGTGCCCACCTGGAGGAGGG - Intronic
1089651967 11:119920426-119920448 GCTGAAGCACAAAGGGAGGCAGG - Intergenic
1090067605 11:123517000-123517022 GCTTGAGCCCAGAAGGTGGAGGG - Intergenic
1090512172 11:127387009-127387031 CCTGGAGGCATGATGGAGGCTGG - Intergenic
1091668924 12:2438611-2438633 GCTGGAGCACAGAATGTGGCTGG + Intronic
1091791552 12:3274873-3274895 GCGGGAGCTGTGATGGAGGCAGG + Intronic
1091852778 12:3713621-3713643 GCTGGAGCTCTGCTGGGGGCAGG - Intronic
1092027612 12:5256031-5256053 GCTGGTGCTGAGATGAAGGCTGG - Intergenic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1092975803 12:13743881-13743903 GATGGGGTCCAGATGGAGGTAGG - Intronic
1093005904 12:14050341-14050363 GCTTGAGCCCAGAAGGTGGAGGG + Intergenic
1095141566 12:38669696-38669718 GCTTGAGCACAGAGGGAGGTGGG + Intronic
1095598067 12:43981389-43981411 GCTGGAGCACAGAAAGAGGAAGG + Intronic
1096238380 12:49944983-49945005 GTTGAGGCCCAGGTGGAGGCAGG - Intergenic
1096489563 12:52006454-52006476 GGTGGAGGCCCGATGGAGGAGGG - Intergenic
1096606192 12:52768252-52768274 TCTGAAGCCCAGATGTAGGGAGG + Exonic
1096678173 12:53236803-53236825 GCTGGAGCACAGATGTAGTTTGG - Intergenic
1098032286 12:66267076-66267098 GCTGCACCCCAGCTGGAGACAGG - Intergenic
1099020364 12:77396076-77396098 ACTTGAGCCCAAATGAAGGCAGG - Intergenic
1099717283 12:86311777-86311799 GGTGGAGGTCAGAAGGAGGCAGG - Intronic
1102072561 12:110033936-110033958 GCTGGAGTCCAGCAGGAGCCAGG + Exonic
1102201484 12:111060641-111060663 GCTGGAACCCAGTAGGAAGCAGG + Intronic
1102563418 12:113778954-113778976 GCCGGAGCCCCCATGGGGGCAGG - Intergenic
1102898520 12:116617894-116617916 GCTGGAACCCAGGAGGAGGAGGG - Intergenic
1103015017 12:117487506-117487528 GCTGGAGCAGAGGTGGAGGAAGG + Intronic
1104004129 12:124880257-124880279 GCTGGAGCCCACAGAGAAGCTGG + Intronic
1104503698 12:129310509-129310531 GCAGGAGCTCAGAGGGAGGGAGG - Intronic
1104581768 12:130016137-130016159 GAGGGAGCCAAGGTGGAGGCTGG + Intergenic
1105962671 13:25356186-25356208 CCTGGAGCCCAGAGTGGGGCAGG + Intergenic
1106683418 13:32031454-32031476 GCTGGAGCCGAGCTGGTGGGCGG + Exonic
1106999675 13:35527780-35527802 GCTGTAGCTCAGTAGGAGGCGGG + Intronic
1107701672 13:43054936-43054958 CCTGGAGCACAGAAGGAGGGCGG + Intronic
1112563532 13:100533709-100533731 GCTGGAGCCAAGATCGCTGCGGG - Exonic
1112788471 13:102977899-102977921 GGTGGAGCTCAGATTCAGGCAGG - Intergenic
1113415180 13:110123447-110123469 GCTGGAGCCCAGCAGGAGCCGGG + Intergenic
1114559369 14:23579205-23579227 GGAAGAGCCCAGATAGAGGCAGG + Intergenic
1114673482 14:24427105-24427127 GCTGGATCCCAGATGGACTCTGG - Exonic
1115907181 14:38212412-38212434 GCTGGAACCCAGAGGGAGCAGGG - Exonic
1116397455 14:44463546-44463568 GCTGGGGCACAGAGGGAGGTTGG - Intergenic
1117320088 14:54613306-54613328 GGTGGAGACCAGAGGGAGGTGGG + Intronic
1117881337 14:60316243-60316265 CTTAGAGCCCTGATGGAGGCAGG + Intergenic
1119399074 14:74349561-74349583 GCTAGAGCCCAGAATGAGGCTGG + Intronic
1121803923 14:96797705-96797727 CGTGGAGCTCAGATGGGGGCCGG - Intronic
1122152187 14:99731280-99731302 GCTGGAGCCCGGGGTGAGGCTGG - Intergenic
1122975487 14:105169051-105169073 GCAGGAGCCCAGGCGGAGGAGGG - Intergenic
1123042974 14:105497985-105498007 GCTGGTGCCCAGAGCGAGGCTGG - Intronic
1123043313 14:105499420-105499442 GCGGGAGCCCAAATGAAGGGGGG - Intronic
1123476710 15:20596199-20596221 TCTGGATCCCAGCTAGAGGCGGG + Intergenic
1123641301 15:22404165-22404187 TCTGGATCCCAGCTAGAGGCGGG - Intergenic
1123995335 15:25714098-25714120 GCTGGAGCCCAACTTGTGGCTGG + Exonic
1124071245 15:26394892-26394914 TCTGGGGCCCAGAAGCAGGCAGG - Intergenic
1124199244 15:27663072-27663094 GCTGGAGCACAGAGGGAGAGGGG - Intergenic
1124553528 15:30705668-30705690 GATGGAATCCAGATGTAGGCAGG + Intronic
1124562872 15:30791714-30791736 GGTGGAGCCCAGAGGCAGTCCGG - Intergenic
1124677717 15:31700000-31700022 GATGGAATCCAGATGTAGGCAGG - Intronic
1125182051 15:36888599-36888621 CCTGGAGCCTAGGAGGAGGCAGG - Intergenic
1125530070 15:40407272-40407294 GCTGGAGCACAGAGGGTGGGAGG + Intronic
1125882999 15:43209592-43209614 GATGGAGCCCAGAAGCATGCAGG - Intronic
1127076162 15:55328016-55328038 GCTGCACCTCAGATAGAGGCTGG - Intronic
1127207315 15:56733777-56733799 GCTCGCACCCACATGGAGGCAGG - Intronic
1127365523 15:58285586-58285608 GCTGGAGTCCAGATGAGGCCTGG + Intronic
1127901694 15:63345719-63345741 CCTGGAGCCCAGAGAGAGGCAGG + Intronic
1128247067 15:66140387-66140409 CCTGGAGGCAAAATGGAGGCAGG + Intronic
1128324423 15:66714690-66714712 GCTTGAGCAGTGATGGAGGCTGG + Intronic
1129108011 15:73322527-73322549 GCTGGACCCCAGAGGGAACCTGG - Exonic
1129254673 15:74327288-74327310 GCTGGGGCCCAGAGCGAGGAAGG - Intronic
1129273677 15:74432503-74432525 GTGGGAGCCCAGGTGCAGGCAGG - Intronic
1129455704 15:75675309-75675331 GCAGGGGCCAAGGTGGAGGCAGG - Exonic
1129929319 15:79396554-79396576 ACTGGAGCCCAGAGGGAAGATGG - Intronic
1130172126 15:81525743-81525765 GCTGGGTCTCAGATGGAGGAAGG + Intergenic
1130966796 15:88703747-88703769 ACTGGAGCACAGATGGGTGCTGG - Intergenic
1132146631 15:99433279-99433301 GATGGAGCCCAGATGCTGGCTGG + Intergenic
1132380614 15:101363365-101363387 GCAGGAGAGCACATGGAGGCTGG - Intronic
1132708952 16:1258140-1258162 GCTGTGGCCCGTATGGAGGCCGG - Exonic
1132868974 16:2107184-2107206 GCTGGACCCTAGCAGGAGGCAGG + Intronic
1132991257 16:2796135-2796157 GCTGGAAGCCACATGGAGGGAGG - Intergenic
1133279694 16:4658179-4658201 GCTGCAGACCAGATGGACGCTGG - Intronic
1133383990 16:5354109-5354131 ACTTGAGCTCAGATGGAGGAGGG - Intergenic
1133839676 16:9396189-9396211 GGTGGGGCCCAGAGGAAGGCAGG - Intergenic
1135690003 16:24528754-24528776 GCTGGAGCCCAGAAGGCTGAAGG - Intergenic
1136187428 16:28596452-28596474 CCTGGAGCCCAGATGGACTGTGG - Exonic
1136189903 16:28609367-28609389 CCTGGAGCCCAGATGGACTGTGG - Intronic
1136317040 16:29460535-29460557 TCTGGAGCCCAGATGGACTGTGG + Intronic
1136319060 16:29470780-29470802 CCTGGAGCCCAGATGGACTGTGG + Intergenic
1136431615 16:30199877-30199899 TCTGGAGCCCAGATGGACTGTGG + Exonic
1136433631 16:30210124-30210146 CCTGGAGCCCAGATGGACTGTGG + Intergenic
1136500378 16:30667207-30667229 GCTGGCACCCAGATGGGGCCTGG - Intronic
1136615828 16:31397850-31397872 GCGCGAGCCCAGCAGGAGGCAGG - Exonic
1136895337 16:33993009-33993031 GCTGTAGCCCAGTCGGGGGCAGG - Intergenic
1137614842 16:49839872-49839894 GCTGGATCCCAGATGGTGAAGGG - Intronic
1137693424 16:50445732-50445754 GCTGGGGCCCAGGCAGAGGCCGG + Intergenic
1138525037 16:57600312-57600334 ACTGGAGCCCAGAGAGGGGCAGG - Intergenic
1139327862 16:66165944-66165966 TCTGGAGCCCAGAAGCAGACTGG + Intergenic
1140228278 16:73096255-73096277 GCTGGAGACCGGGTGGTGGCTGG + Intergenic
1140868100 16:79081781-79081803 GCTGGAGACCAGAGGCAGCCAGG - Intronic
1141503669 16:84461328-84461350 GCTGGAGGGAAAATGGAGGCAGG - Intronic
1141746482 16:85929791-85929813 GCGGGAGACCAGAGGGAGGGAGG + Intergenic
1141746501 16:85929887-85929909 GCTGGAGCCCAGGAGGAGGGCGG - Intergenic
1142008260 16:87700639-87700661 GCTGGAGGGCAGAGGGAGGAGGG + Intronic
1142112663 16:88340614-88340636 GCTGAGGCCCAGAGGGAGGAAGG + Intergenic
1142178671 16:88656739-88656761 GCTGGAGCCCTGTGGGAGGAGGG - Intronic
1142264035 16:89055418-89055440 GGTGGAGCCCAGGTGGGGGCTGG - Intergenic
1203077696 16_KI270728v1_random:1130612-1130634 GCTGTAGCCCAGTCGGGGGCAGG + Intergenic
1142644066 17:1300798-1300820 GCTAGAACCAAGATGGAGCCGGG - Exonic
1142804278 17:2363317-2363339 GCTGGAGAGCAGAGGGTGGCTGG + Intronic
1142921388 17:3190150-3190172 GCTTGGGCACAGAGGGAGGCGGG - Intergenic
1143199595 17:5103082-5103104 GCTGGAGTCTAGAGGGAGGGTGG + Intergenic
1143503964 17:7353757-7353779 ACTGGAGCTCAGATGTGGGCAGG + Exonic
1143787262 17:9265287-9265309 TCTGGGGCCCAGATTGGGGCAGG + Intronic
1143881512 17:10033723-10033745 GCTGGATCGCAGGTGCAGGCGGG - Intronic
1144232565 17:13222794-13222816 GTTGGAGCCAAGATGGAGAGCGG + Intergenic
1145785132 17:27588577-27588599 GCTGGTACCCAGATGGGGCCAGG + Intronic
1146001315 17:29132169-29132191 GCTGGAGCCCAGGAGCTGGCTGG + Intronic
1146262734 17:31432305-31432327 GCAGCAGCTCAGAGGGAGGCGGG - Intronic
1146637782 17:34518921-34518943 TCTGGATCCCAGATGGATCCTGG + Intergenic
1147120090 17:38330681-38330703 GCTGGAGCCAAGGTGGAGGTGGG + Exonic
1148199996 17:45743895-45743917 CCTGGAGCCCAGACTGAGGGTGG + Intergenic
1148330876 17:46813275-46813297 AATGAAGCCCAGAAGGAGGCAGG + Intronic
1148748654 17:49932149-49932171 GCTGGGGCCCAGATGCAGGCTGG + Intergenic
1149574875 17:57704617-57704639 GCTGGAGCGCAGACAGGGGCTGG - Intergenic
1150106229 17:62464521-62464543 GCTGGAGATGAGATAGAGGCAGG + Intronic
1150292510 17:63989585-63989607 GCTGGAGCCCAAGTGGTCGCAGG - Intergenic
1150468269 17:65413964-65413986 CCTGTAGCCCAGCTAGAGGCAGG + Intergenic
1150952670 17:69821196-69821218 CCTGGGGCCCAGAAGCAGGCAGG + Intergenic
1151146493 17:72046456-72046478 GCTGAAGCACAGAAGGTGGCTGG + Intergenic
1151448433 17:74182246-74182268 GCTGGAGCTGGGAGGGAGGCAGG - Intergenic
1151785394 17:76272626-76272648 ACAGGAGCCCAGCTGGAGCCTGG + Intergenic
1151921008 17:77155492-77155514 GCTGGTGCCCAGATGGGAGCTGG + Intronic
1151974980 17:77479676-77479698 CCTGGAGCCCAGAGCGAGGGAGG - Intronic
1152258984 17:79256391-79256413 GCTGAAGCCCAGAGTGAGGATGG + Intronic
1152689442 17:81711426-81711448 GCAGGGGCCCAGATGCAGGCAGG + Intergenic
1152866735 17:82728512-82728534 GCTTGAGCCCAGAAGGCGGAGGG - Intronic
1153226847 18:2906495-2906517 GCCGGAGCCAAGAGTGAGGCCGG + Intronic
1153527835 18:6014650-6014672 GCTGGAGCTCAGAGTGGGGCAGG + Intronic
1153930154 18:9871320-9871342 GATGGGGCCAGGATGGAGGCTGG - Intergenic
1156392502 18:36664031-36664053 GCTGGATCCCAGATGCTTGCTGG + Intronic
1156495409 18:37522394-37522416 GCTGGAGCTGAGATGGAAGAGGG + Intronic
1157601083 18:48893651-48893673 GGTGGAGCCCTGTAGGAGGCTGG - Intergenic
1158488852 18:57892211-57892233 ACTGGAGCCTAGCTGGAGGCTGG - Intergenic
1158679689 18:59556122-59556144 GCAGGAACCAAGCTGGAGGCTGG - Intronic
1160479752 18:79227717-79227739 GCTGGAGCCCACATGCAGTGAGG - Intronic
1160840743 19:1146074-1146096 GCTGGCGCCACGCTGGAGGCCGG - Intronic
1160855926 19:1217801-1217823 GATGGAGCCCAGACTGTGGCAGG - Intronic
1160965210 19:1744442-1744464 TCTGGAGGCCAGGAGGAGGCCGG - Intergenic
1161298523 19:3531889-3531911 CCTGGAGGCCAGGTGGAAGCGGG - Exonic
1161934972 19:7365894-7365916 GATGGGGCCAAGATGCAGGCAGG - Intronic
1162723227 19:12674676-12674698 GATGGAGCCCAGCTGGTGGCAGG + Intronic
1163086936 19:14988256-14988278 GCTGGGGCACAGAGGGAGGTGGG - Intronic
1163127783 19:15253609-15253631 GCTGGGGCCCAGGTGATGGCAGG + Intronic
1163309766 19:16506888-16506910 GCTTGAGCCCAGTTTGAGGACGG - Intronic
1163700575 19:18784748-18784770 GCGGGAGCCCAGAGGAGGGCTGG + Intronic
1163723630 19:18910263-18910285 CCTGGAGCCCAGTGGGAGGGTGG - Intronic
1164920179 19:32083450-32083472 ACTGGAGCCAAGGGGGAGGCTGG - Intergenic
1165376004 19:35442451-35442473 GCTGGAACCCAGGAGGAGGAGGG + Intergenic
1165935184 19:39384663-39384685 GTTGGGGCCCAGGTGGAGGGAGG + Exonic
1166828597 19:45624966-45624988 ACTGCAGGCCGGATGGAGGCAGG - Intronic
1167571517 19:50292003-50292025 GCTGGAAGCCTGATGGAGCCTGG - Intronic
1168255442 19:55162100-55162122 ACCCGATCCCAGATGGAGGCCGG + Intronic
1168309454 19:55453084-55453106 GGCTGAGCCAAGATGGAGGCGGG - Exonic
1168586048 19:57593122-57593144 GCTGGAACCCAGGAGGAGGTTGG - Exonic
925303265 2:2831933-2831955 GGAGGAGCCCAGAGGGAGGGGGG + Intergenic
925741896 2:7012662-7012684 GCTGCAGCCCTGCTGGAGGCTGG + Intronic
925900210 2:8503878-8503900 GCTGGTGCCCAGACTGAGGGTGG - Intergenic
927132840 2:20074990-20075012 GCTGAAGGCAGGATGGAGGCAGG - Intergenic
927553530 2:24017776-24017798 GAAGGAACCCAGAAGGAGGCAGG - Intronic
927679020 2:25127934-25127956 GCTGGAGCCCAGATGGTACCAGG + Intronic
932130247 2:69181004-69181026 GCTGGAGCTCAGGAGGAGGGGGG + Intronic
932586025 2:73029575-73029597 GCTGGTGGCAAGATGGAGACAGG + Intronic
932797289 2:74707751-74707773 GGTGGAACCCAGATGGAGCCTGG + Intergenic
933748716 2:85589393-85589415 CCTGGAGCCAAGATGGACCCAGG - Intronic
933887254 2:86730078-86730100 GTTGGTGCACAGATGGAGTCTGG + Intronic
933922921 2:87066635-87066657 GTTGGTGCACAGATGGAGTCTGG - Intergenic
934110643 2:88739071-88739093 GCTGGAGTCCTGGTTGAGGCTGG + Intronic
934775084 2:96932246-96932268 GATGATGCCCAGCTGGAGGCTGG - Intronic
935629003 2:105196700-105196722 GGGGGAGGCCAGATGGAGGGTGG - Intergenic
936947689 2:117945355-117945377 GCTAGGCCTCAGATGGAGGCAGG - Intronic
937124082 2:119462147-119462169 GCTGCAGGCCTGATGGAGGAAGG - Intronic
937983016 2:127625884-127625906 GCTGAGGCCCAGAGGCAGGCAGG - Intronic
939252913 2:139706036-139706058 GTTGGTGCACAGAGGGAGGCAGG + Intergenic
939328774 2:140730958-140730980 GCTAGAGTCAAGATGGAGGCAGG - Intronic
939966008 2:148610889-148610911 GGTGGAGAACAGATGGAGGAAGG + Intergenic
942070850 2:172313970-172313992 GCTGGTGCCCAGATGGCTTCAGG + Intergenic
943264595 2:185712289-185712311 GCTGGATCACAGATGAAGTCAGG - Intergenic
946133299 2:217624442-217624464 GCAGGAGATCAGATGGAGGATGG - Intronic
946397941 2:219452702-219452724 GTTGGTGCCCTGAAGGAGGCTGG + Intronic
946434132 2:219640817-219640839 GATGCAGCCCAGCTGGATGCAGG - Exonic
947356476 2:229301137-229301159 GTTGGAGTCCAAATGGAGGGAGG - Intergenic
947443847 2:230148122-230148144 CCTGGAGGCTTGATGGAGGCTGG + Intergenic
948309426 2:236973983-236974005 GCTAGAGGCAAGATGGAGTCAGG - Intergenic
948892774 2:240915381-240915403 GCTGGTGGCCAGTTGGGGGCAGG + Intergenic
948935139 2:241158986-241159008 GCGGGAACCCAAAGGGAGGCAGG - Intronic
1168861733 20:1050542-1050564 GCTGGTGCCCACATGGAACCTGG - Intergenic
1168955023 20:1828685-1828707 CCAGGAGCCCAGAGGGAAGCTGG + Intergenic
1169551023 20:6701305-6701327 TCCTGAGCCCAGAGGGAGGCAGG + Intergenic
1170537883 20:17359465-17359487 AATGGAGCTCAGATGGAGGTTGG - Intronic
1171204141 20:23266153-23266175 GCTTGAACCCAGAAGGAGGGAGG + Intergenic
1172444359 20:34985298-34985320 GCTGGAGACCAGGCAGAGGCTGG - Intronic
1172670362 20:36630762-36630784 GCAGCAGCTCAGAGGGAGGCAGG + Intronic
1172766264 20:37352687-37352709 GCTGAAGCTCAGAGAGAGGCGGG + Intronic
1173514182 20:43653289-43653311 GCTTGAGGCCACATGGAGGGAGG + Intergenic
1173933357 20:46840137-46840159 TCTGGAGCCCTGAAGCAGGCAGG + Intergenic
1175092169 20:56513453-56513475 TCTGGAGCAGAGATGGGGGCTGG - Intronic
1175418728 20:58817926-58817948 CTTGGAGCTGAGATGGAGGCGGG - Intergenic
1175623815 20:60473816-60473838 CCTGGACCCAAGCTGGAGGCAGG - Intergenic
1176020476 20:62960189-62960211 TCTAGAGCACAGCTGGAGGCCGG + Intronic
1176045304 20:63089576-63089598 GCGGGCGACCAGACGGAGGCTGG + Intergenic
1176045316 20:63089616-63089638 GCGGGCGACCAGACGGAGGCTGG + Intergenic
1176045328 20:63089656-63089678 GCGGGCGACCAGACGGAGGCTGG + Intergenic
1176285273 21:5016067-5016089 CCTGGTTCCCAGAAGGAGGCTGG + Intergenic
1177728268 21:24995288-24995310 GCTGGGGCACAGAAGGAGGGGGG + Intergenic
1178425727 21:32477493-32477515 GTTGCAGCCCGGATGGTGGCTGG + Intronic
1179308075 21:40172965-40172987 GCTGGTGCCCAGATGGGGAAAGG + Intronic
1179600705 21:42475792-42475814 CCTGGGGCCCAGCTGAAGGCAGG + Intronic
1179871908 21:44247408-44247430 CCTGGTTCCCAGAAGGAGGCTGG - Intronic
1180143489 21:45907041-45907063 GCTGAAGGCCAGGCGGAGGCCGG + Intronic
1180143835 21:45908985-45909007 GCTGGAGACTAGCTGGGGGCTGG - Intronic
1180589483 22:16924151-16924173 GGGGGAGTCCAGATGAAGGCTGG + Intergenic
1180878130 22:19184810-19184832 CCTGGAGCCCAGCTCGAGTCAGG + Intronic
1180899049 22:19357688-19357710 GCTGGAGCTCAGACGCAGGCAGG + Intronic
1181108259 22:20587263-20587285 GCTGAGGCCCAGCTGGTGGCGGG - Exonic
1181545439 22:23599688-23599710 GCTGGAGGGCAGAGGGAGGAAGG - Intergenic
1181814871 22:25430211-25430233 GCTGGAGGGCAGAGGGAGGAAGG + Intergenic
1182049797 22:27303950-27303972 GCTGGAGCCCAGATGTGGAGGGG + Intergenic
1182225086 22:28791507-28791529 GCTTGAGCCCAGTTCGAGACCGG - Intergenic
1182585976 22:31344631-31344653 GATGTAGCCCAGCTGGAGGCTGG + Exonic
1183292420 22:37010830-37010852 GATGGAGCCCAGAGAGAGGCAGG + Intergenic
1183731144 22:39619255-39619277 GCTGGAGGCCAGCTGGGGCCAGG - Intronic
1183983802 22:41558131-41558153 GCTGGAGCCATGGTGGACGCTGG - Intergenic
1184901913 22:47451595-47451617 GCTGGTGCCCAGATGGACCAGGG - Intergenic
1185039745 22:48497922-48497944 GGTGGGGCCCACCTGGAGGCGGG + Intronic
1185039759 22:48497957-48497979 GGTGGGGCCCACCTGGAGGCGGG + Intronic
1185039773 22:48497992-48498014 GGTGGGGCCCACCTGGAGGCGGG + Intronic
1185039822 22:48498129-48498151 GGTGGGGCCCACCTGGAGGCGGG + Intronic
1185039871 22:48498266-48498288 GGTGGGGCCCACCTGGAGGCGGG + Intronic
1185384418 22:50525335-50525357 GCTGGAGGCCGGAGCGAGGCTGG - Intronic
949940432 3:9150322-9150344 GCTGGAGCCCAGAAGTAAGAAGG + Intronic
950027757 3:9832513-9832535 CCTGGAGCCCAGCTGAGGGCAGG + Intronic
950116023 3:10450727-10450749 TCTGGAGCCCAGGAGGAGGTGGG + Intronic
950358114 3:12428690-12428712 GCTGGTGACCAGTTGGAGGGTGG + Intronic
950545497 3:13635804-13635826 CCTGGAGCCCAGGTTGAGGGGGG + Intronic
950640257 3:14344054-14344076 CCGGGAGCCCAGGGGGAGGCTGG + Intergenic
952120021 3:30231385-30231407 CCTGGGGCCCAGGTGGAGGGTGG + Intergenic
952828244 3:37541756-37541778 ACAGGAACCCAGATGAAGGCTGG - Intronic
953503447 3:43460196-43460218 CCTAGAACCCAGATGGAGGCAGG + Intronic
953714872 3:45308608-45308630 GCTGGACCACAGAGGGAGGTGGG + Intergenic
954152112 3:48662768-48662790 GATGGTGCCCAGAGGGCGGCGGG - Exonic
954457533 3:50607955-50607977 GTTGGAGTCCAGACGGAAGCTGG + Exonic
954519706 3:51213831-51213853 GCTGGACCCTAGTTGGACGCTGG + Intronic
954664774 3:52245925-52245947 GCTGGAGCCGCGAAGGAAGCGGG - Intronic
954699933 3:52445802-52445824 ACTGGAGGCCTGAGGGAGGCAGG - Intergenic
955218405 3:57003880-57003902 GCTGGAGTCCAGATGCCAGCAGG - Intronic
955741746 3:62098524-62098546 GCTGGGGCCAAGGTGGAGGGTGG - Intronic
955779602 3:62470287-62470309 GTTGGGACCCAGGTGGAGGCTGG + Intronic
958615928 3:96493765-96493787 GCTGGAGCACAGATGGGCGAGGG - Intergenic
959934547 3:112015409-112015431 GCTGGAGCCCAGCTGGAGTGAGG + Intergenic
961537367 3:127578248-127578270 GCTGCAGCCCAGTGGGAGCCTGG - Intronic
961771751 3:129255091-129255113 GCTGGAGCCCTGCTGGGGGTGGG + Intronic
961832555 3:129631562-129631584 GCTTGAGCCCAGTTCAAGGCTGG + Intergenic
963460231 3:145603316-145603338 GCTGGATCTCAGATGGGGGCAGG - Intergenic
964415585 3:156444414-156444436 GCTTGAGCTATGATGGAGGCTGG + Intronic
964431791 3:156614994-156615016 GCTGGATCACTGATGGAGGCTGG - Intergenic
965735023 3:171810471-171810493 GCTGGAGCTCAGCGGGAGGGAGG + Exonic
966597246 3:181735676-181735698 GCTGGAGAACAGACAGAGGCGGG + Intergenic
966807701 3:183819532-183819554 GCTGGAGCCCAGATGGGAGAGGG + Intronic
966840485 3:184083489-184083511 GCTGCAGCCCAGCTGAAGGGTGG - Intergenic
966939211 3:184734904-184734926 GCTGGACCCCAGCTAGAAGCAGG - Intergenic
968427673 4:534320-534342 GCTGGTGGCCAGATGGAGGGCGG + Intronic
968468398 4:764637-764659 GCTGCAGGCCAGATAGGGGCGGG + Intronic
968615100 4:1574207-1574229 GCAGGAGCCCAAAGGAAGGCTGG - Intergenic
968761233 4:2443566-2443588 GCTGGAGCCTACATGCTGGCTGG + Intronic
968864842 4:3201974-3201996 GCTGGCTCCCAGATGGGAGCTGG + Intronic
969044135 4:4324228-4324250 GCTTGAGCACAGAGGGAGGAGGG + Intergenic
969502001 4:7558981-7559003 GCTGAGGCCCAGATAGGGGCAGG - Intronic
969632540 4:8346890-8346912 TGTGGAGCCCAGGTGGGGGCTGG + Intergenic
973187611 4:47349132-47349154 TCTGGAGCACAGAGGGAGGGAGG + Intronic
976011096 4:80489516-80489538 GATGTAGCCCAGATAGAGGAAGG - Intronic
976036130 4:80823276-80823298 GTTGGAGCAAAGAGGGAGGCAGG - Intronic
976921777 4:90451571-90451593 GCTGGAACCCAGCTGGAAGCTGG + Intronic
978339412 4:107706835-107706857 GCTGGAGTCCTCAGGGAGGCTGG + Intronic
979224225 4:118265834-118265856 GCAGGAGCCCAGGTGGGGGGAGG - Intergenic
979545305 4:121933230-121933252 GCTAGATCCCAGAAGGAAGCCGG + Intronic
981010524 4:139920823-139920845 GCAGGAGCCCAGCTGGGGCCAGG + Intronic
982361502 4:154524020-154524042 GCTGGAGCCCAGATGGAGGCTGG + Intergenic
982389434 4:154848490-154848512 GCTTGAGCACAGAGGGAGGTGGG - Intergenic
982822269 4:159955906-159955928 GCTGTAGCCCAGCTGCAGCCGGG - Intergenic
984361708 4:178742832-178742854 TCTGGAGCGCAGACGCAGGCAGG - Intergenic
985912435 5:2895002-2895024 GCTGGATGACAGATGGTGGCTGG + Intergenic
986348630 5:6856943-6856965 GCTGGAGCCCGGCAGGAGCCTGG - Intergenic
989225465 5:39022616-39022638 GCTGGGGGACAGATGGAGGTGGG + Intronic
989229783 5:39073815-39073837 GCTCGAGCCCAGAGGGTCGCCGG + Intronic
992098118 5:73381366-73381388 GCTGGAGGCGAGGTGGGGGCGGG - Intergenic
992105836 5:73448409-73448431 GCTGGGGCGCAGAGGGAGCCCGG - Intergenic
993733728 5:91451432-91451454 GGTGGTGGCCAGATGGTGGCTGG + Intergenic
994281066 5:97902748-97902770 GGTGGAGCCTAGAGGCAGGCAGG + Intergenic
994290422 5:98023123-98023145 GGTGGAGCCTAGAGGCAGGCAGG - Intergenic
997526952 5:134559764-134559786 CCTGGAGCCCCTATGGCGGCAGG + Intronic
997859729 5:137405605-137405627 TCTGGAGCTCAGATGGACTCGGG - Intronic
998525737 5:142841674-142841696 GCAGGAGCCAAGATGAAGTCAGG - Intronic
999858579 5:155621122-155621144 GCTGGAGACCAAGGGGAGGCCGG - Intergenic
1002043624 5:176530547-176530569 CCTGGAGCCCAGGTGGGGGTCGG + Intronic
1002082891 5:176748085-176748107 GCTGCACCCCAGATGCAGCCAGG + Intergenic
1002333608 5:178462851-178462873 GCTGGAGCCAAAATGGAAACTGG + Intronic
1002409548 5:179062702-179062724 TTTGAAGCCCAGAAGGAGGCAGG + Intronic
1003021232 6:2511340-2511362 GCAGGAAGCCAGATGGAGCCTGG - Intergenic
1003589125 6:7422329-7422351 GCTTGAGCCCAGATGGTCGAGGG - Intergenic
1003823528 6:9927148-9927170 CCTTGAGCCCAAATGGAGGATGG - Intronic
1003850987 6:10222387-10222409 GGTGGAGGCGAGGTGGAGGCTGG - Intergenic
1006341282 6:33448546-33448568 GAGGGAGGCCAGAGGGAGGCTGG - Intronic
1006418860 6:33921045-33921067 GCTGGAGTGCAGACAGAGGCAGG + Intergenic
1006429469 6:33986089-33986111 GCTGGAACCGAGAGAGAGGCTGG - Intergenic
1006454447 6:34123859-34123881 GCTGGAGACCAGAGAGAGGAAGG - Intronic
1006559433 6:34897059-34897081 GCTAGAGCCCAGAAGGTGGAAGG + Intronic
1007381627 6:41493934-41493956 GCTGGTGGCCAGATGGAGAGAGG - Intergenic
1007424918 6:41740595-41740617 GCTGGAGCCCTGCTGGCTGCAGG + Exonic
1007654105 6:43441871-43441893 GCTGGAGACCAGACAGAGGTGGG + Exonic
1007728912 6:43933826-43933848 GCTGGGCCTCAGATGGAGCCTGG - Intergenic
1007783093 6:44265237-44265259 GCTGGAGCCGAGGTGGACTCGGG + Exonic
1007933257 6:45711148-45711170 GCTGGAGCTCTGATAGAGGGCGG - Intergenic
1008718306 6:54317125-54317147 GCAGTAACCCAGATGGAGGTAGG - Intronic
1011381465 6:86746404-86746426 TCTGGAGCCCAGATCGGGGCAGG - Intergenic
1015965353 6:138692317-138692339 GCCGGACCCCAGCGGGAGGCTGG - Intronic
1016385744 6:143529353-143529375 GCAGGAGCCCAAATGTGGGCTGG - Intergenic
1017655776 6:156627740-156627762 GCTGGAGGCCTGTGGGAGGCGGG - Intergenic
1017791721 6:157805474-157805496 CTGGGAGCCCACATGGAGGCAGG - Intronic
1018638189 6:165883457-165883479 GCTTGAACCCAGATGGTGGGAGG + Intronic
1018647499 6:165961850-165961872 GGTTGTGCCCAGATGGAGGGTGG - Intronic
1018866700 6:167751999-167752021 GATGGAGCCCGCATGAAGGCTGG - Intergenic
1018972245 6:168537783-168537805 GCTGGAGCCCACAGGGTGGATGG + Intronic
1019039802 6:169094389-169094411 ACCATAGCCCAGATGGAGGCCGG - Intergenic
1019421926 7:954620-954642 GGCGGAGCCCAGAGGGCGGCGGG - Intronic
1019467858 7:1200183-1200205 GCTCGAGGCCAAGTGGAGGCCGG - Intergenic
1019564780 7:1673914-1673936 GCTGGAACCCAGGCTGAGGCAGG + Intergenic
1019594239 7:1851043-1851065 GCTGGAGCCAACAAGGTGGCAGG + Intronic
1019606359 7:1912138-1912160 GCAGGGGTCCAGATGGCGGCAGG + Intronic
1019801968 7:3094513-3094535 ACTGGAAACCAGAAGGAGGCGGG + Intergenic
1023564079 7:41506198-41506220 GTTGCAGCCCAGAGAGAGGCAGG - Intergenic
1023969631 7:44981335-44981357 GTAGGAGCCCTGGTGGAGGCAGG - Intergenic
1025284546 7:57651324-57651346 GCTGCAGCCGCGATGGTGGCTGG + Intergenic
1025846180 7:65200295-65200317 CCTAGAGCCCAGAAGGAAGCTGG + Intergenic
1027661977 7:80998075-80998097 TCAAGAGCCCAGATGGAGCCTGG - Intergenic
1028582779 7:92424468-92424490 GCTGGAAGCCAGACAGAGGCGGG - Intergenic
1029287946 7:99479003-99479025 GCTGGAGCCCAGAAGGCTGCTGG - Intronic
1030128613 7:106178377-106178399 GCTGGAGCTCAGAGCAAGGCTGG - Intergenic
1032035295 7:128517109-128517131 GCTGGAGATGAGATAGAGGCAGG + Intergenic
1032087888 7:128893247-128893269 GCTGGCGGCCAGAGGCAGGCAGG + Exonic
1032090552 7:128909644-128909666 GAAGGGGCACAGATGGAGGCAGG - Intronic
1032095913 7:128938432-128938454 CCGGGAGCCCCGCTGGAGGCTGG + Intronic
1032167647 7:129558269-129558291 GCTGGAGCCGGGGTGGGGGCGGG - Intergenic
1032193412 7:129777110-129777132 GCTGGAGAACAGATGGAGCCAGG + Intergenic
1032507408 7:132446030-132446052 CCAGGAGCCCCGATGGAGGAAGG + Intronic
1034241973 7:149617675-149617697 GCCTGGGCTCAGATGGAGGCAGG + Intergenic
1035607055 8:936635-936657 GCTGGAGCCTAGTTGGAAGCTGG + Intergenic
1035712351 8:1728241-1728263 GCTGGAGGGCAGGTGGGGGCGGG + Intergenic
1037260410 8:17001704-17001726 GCTGGGGCGCAGATGGGGGTGGG + Intronic
1039886400 8:41656537-41656559 GCTGGAGGCCCCATGGGGGCAGG - Intronic
1040463135 8:47669419-47669441 GCTGCAGCTCAGAGGCAGGCTGG - Intronic
1041465131 8:58150876-58150898 GCTGCAGACAAGATGGCGGCTGG + Intronic
1042229260 8:66540442-66540464 CCTGCAGCCCAGAATGAGGCTGG - Intergenic
1042239121 8:66645014-66645036 GCTTGAGCCCAGTTGGTGGTGGG + Intronic
1042517912 8:69679014-69679036 GCTGGACCCCAGAGGAGGGCAGG - Intronic
1042586426 8:70344270-70344292 GCTGAAGACCAGATGGGGACTGG + Intronic
1044646067 8:94444662-94444684 ACTGGAGCTCAAAAGGAGGCTGG - Intronic
1045098312 8:98821160-98821182 GCTGGAGCCCAGAGCAAGGGCGG - Intronic
1047343915 8:124009209-124009231 GCTGGAGTGCAGAAGGAGGATGG - Intronic
1047714842 8:127586101-127586123 GCAGGAGGCAAGAGGGAGGCAGG - Intergenic
1047764986 8:127983115-127983137 ACAGGAGGCCAGAGGGAGGCAGG - Intergenic
1048968233 8:139629243-139629265 GCTGGGGCCGAGATGCATGCGGG + Intronic
1049061391 8:140278753-140278775 GCGGGTGCCCAGATGGAGCCTGG - Intronic
1049164459 8:141117644-141117666 GCGGGCCCCCAGGTGGAGGCAGG - Intronic
1049202399 8:141346727-141346749 GATGGAGTGCAGATGGAGTCGGG - Intergenic
1049358356 8:142199788-142199810 GCTGGAGCCCTGTGGGAGGCGGG - Intergenic
1049974344 9:847157-847179 GCTGGGGTTCACATGGAGGCTGG + Intronic
1050526156 9:6548664-6548686 GCTGTTGCCCAGGTGCAGGCGGG + Intronic
1053489232 9:38487253-38487275 GCTGGAGCCCGGTTAGGGGCTGG + Intergenic
1054808142 9:69412516-69412538 GCTGGAGCCCAGAGGCAGGAGGG - Intergenic
1056271709 9:84953949-84953971 GCTGGAGCCGGGATGGAAGTGGG + Intronic
1056665542 9:88578261-88578283 GCTGGACCCCAGGTGGAGACGGG + Intronic
1056777595 9:89525092-89525114 GCTGCAGCCGAGACTGAGGCCGG - Intergenic
1056822928 9:89856281-89856303 CCTAGAGGCCAGATGGAGGTTGG + Intergenic
1057141212 9:92727784-92727806 GGTGGGGCCCTGAAGGAGGCAGG - Intronic
1057417847 9:94881057-94881079 GATGGAGGTCAGAAGGAGGCAGG + Intronic
1057669584 9:97076567-97076589 GCTGGAGCCCGGTTAGGGGCTGG + Intergenic
1057815622 9:98291915-98291937 GCTGGAGGCAAGATGGAGCTGGG + Intronic
1057948529 9:99351285-99351307 GTAGGAGCCTAGATGGAAGCTGG - Intergenic
1058164591 9:101605617-101605639 ACTGAAGGTCAGATGGAGGCTGG + Intronic
1060069013 9:120530328-120530350 ACTGGAGCCAGGCTGGAGGCAGG - Intronic
1060222657 9:121772857-121772879 GCTGCAGCTCAGCTGGTGGCCGG + Exonic
1060236016 9:121863093-121863115 GCAGGAGCCCAGGAGGAAGCAGG - Intronic
1060424499 9:123493243-123493265 ACTGGAGCCTTGAGGGAGGCAGG + Intronic
1060516741 9:124270681-124270703 GCAGGGGCCCGGATGCAGGCAGG - Intronic
1060676788 9:125522626-125522648 GCTGGAGGCCAGAAGAAGGTTGG - Intronic
1060720313 9:125972198-125972220 GGTGGCGCCCAGACGGAAGCAGG - Intergenic
1061040042 9:128135997-128136019 CCTAGAGGCCAGATGGAGGTTGG - Intergenic
1061399648 9:130361454-130361476 GCTGGTGGCCATATGGAGGCTGG + Intronic
1061759657 9:132841660-132841682 ACTGAGGCCCAGATGGAGGAAGG - Intronic
1061919941 9:133777226-133777248 GCTGGAGCCCAGAGAGAAGATGG - Intronic
1061955012 9:133956804-133956826 GCGGGAGCCCAGTGGGAGGGAGG + Intronic
1062044464 9:134418632-134418654 GCAGGGGCACAGATGAAGGCCGG - Intronic
1062194999 9:135268037-135268059 TCTGGAGCCGGGATTGAGGCTGG - Intergenic
1062293708 9:135811939-135811961 GCTGGAACCCAGAAGCAGGGCGG + Intronic
1062385691 9:136310678-136310700 GCTGGGGCCCAGAGGGTGGGGGG - Intergenic
1062416199 9:136451527-136451549 TCTGGTGACCAGAGGGAGGCAGG + Intronic
1062424746 9:136500893-136500915 GCTGCAGCCCAGGGGGAGGGGGG + Intronic
1186515645 X:10164569-10164591 GCTGGAGGCCAGATGGGGAGTGG + Intronic
1188012806 X:25075469-25075491 GATTGAGCCCAGATAGAGGCAGG - Intergenic
1191754543 X:64580215-64580237 GCTGGGGCACGGATGGGGGCAGG + Intergenic
1195404588 X:104498994-104499016 GCTGTAGACCACATGGAGTCTGG + Intergenic
1196102248 X:111858778-111858800 GCTGGGGCACAGAGGAAGGCAGG - Intronic
1196764975 X:119235390-119235412 GCTGGAGCCCAGACAAAGGCGGG - Intergenic
1196885014 X:120236156-120236178 TCTGGAGCCCAGTTGGAGTTGGG + Intergenic
1197191100 X:123648611-123648633 GCTGGAGCTCAGCGGGAGGAGGG + Intronic
1197369306 X:125606742-125606764 AAGGGAGCCCAGATGGAGGGTGG - Intergenic
1197758806 X:130013928-130013950 GCTGGAGTAAAGATGGGGGCTGG - Exonic
1198460939 X:136862387-136862409 ACTGGAGCCCAGTTGGATGGGGG + Intronic
1201564897 Y:15355497-15355519 GGTGGAGGCCAGAGGGTGGCAGG - Intergenic