ID: 982369179

View in Genome Browser
Species Human (GRCh38)
Location 4:154615199-154615221
Sequence CAAGTATTCCACTTCTAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982369179_982369181 7 Left 982369179 4:154615199-154615221 CCATTTTAGAAGTGGAATACTTG No data
Right 982369181 4:154615229-154615251 GGCTTTTAACTGACTTATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982369179 Original CRISPR CAAGTATTCCACTTCTAAAA TGG (reversed) Intergenic
No off target data available for this crispr