ID: 982369334

View in Genome Browser
Species Human (GRCh38)
Location 4:154617242-154617264
Sequence TGTTCAATTTGTCTCAATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982369334_982369336 15 Left 982369334 4:154617242-154617264 CCTGGATTGAGACAAATTGAACA No data
Right 982369336 4:154617280-154617302 AGTGTTTTGCTGTGCCACATTGG No data
982369334_982369337 28 Left 982369334 4:154617242-154617264 CCTGGATTGAGACAAATTGAACA No data
Right 982369337 4:154617293-154617315 GCCACATTGGTATCTGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982369334 Original CRISPR TGTTCAATTTGTCTCAATCC AGG (reversed) Intergenic
No off target data available for this crispr