ID: 982369337

View in Genome Browser
Species Human (GRCh38)
Location 4:154617293-154617315
Sequence GCCACATTGGTATCTGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982369333_982369337 29 Left 982369333 4:154617241-154617263 CCCTGGATTGAGACAAATTGAAC No data
Right 982369337 4:154617293-154617315 GCCACATTGGTATCTGCTACTGG No data
982369334_982369337 28 Left 982369334 4:154617242-154617264 CCTGGATTGAGACAAATTGAACA No data
Right 982369337 4:154617293-154617315 GCCACATTGGTATCTGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982369337 Original CRISPR GCCACATTGGTATCTGCTAC TGG Intergenic
No off target data available for this crispr