ID: 982371892

View in Genome Browser
Species Human (GRCh38)
Location 4:154642715-154642737
Sequence GAGTGGGTCAATATAAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982371892_982371896 3 Left 982371892 4:154642715-154642737 CCTCAATTTATATTGACCCACTC 0: 1
1: 0
2: 0
3: 20
4: 139
Right 982371896 4:154642741-154642763 AATTTGCATGTAATTGACATTGG 0: 1
1: 0
2: 29
3: 151
4: 508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982371892 Original CRISPR GAGTGGGTCAATATAAATTG AGG (reversed) Intronic
901140238 1:7024406-7024428 GTTTGGGTAAATATAAAATGGGG + Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
907026419 1:51124635-51124657 GAGTGGATCAATGCAAATGGAGG + Intronic
908555799 1:65255167-65255189 GAGGGGCTCGATAAAAATTGTGG - Intronic
908748239 1:67395998-67396020 GAGTGGGTGAAGAGAACTTGAGG - Exonic
909761014 1:79287327-79287349 GAGTTTGTCAAAATAAACTGAGG - Intergenic
909809102 1:79908151-79908173 GAGTGGGGCAAAATAAGTGGTGG - Intergenic
911950374 1:104166275-104166297 GGTTGGGTCATTATAATTTGGGG - Intergenic
913454097 1:119013393-119013415 GAGTGGGTTGTTATAAAGTGAGG + Intergenic
914508794 1:148312329-148312351 GAGAGGGACAATATATAATGAGG + Intergenic
917563463 1:176185215-176185237 AAATGAGTCAATATATATTGTGG - Intronic
918389784 1:184047251-184047273 GAGTGAGAAAATGTAAATTGAGG - Intergenic
918726671 1:187934409-187934431 GATTGGTGCAATAGAAATTGTGG - Intergenic
919095216 1:193025694-193025716 GACAGGGTAAATGTAAATTGTGG - Intronic
920064053 1:203252852-203252874 GAGTGGGTTGTTATAAAGTGAGG - Intronic
920624146 1:207579625-207579647 GAGTGGATCAATGCAGATTGAGG - Intronic
924070820 1:240276409-240276431 GTGAGGGACAATATAATTTGAGG + Intronic
1063905072 10:10773193-10773215 AGGTGGGTCAATATAAAAGGTGG - Intergenic
1063925783 10:10975946-10975968 GGGTGGGTCAATGGAAATTGAGG + Intergenic
1064710903 10:18123421-18123443 GAGTGGGTTAATGCAAATGGAGG - Intergenic
1065679080 10:28210499-28210521 GAGAAGGTCAAGATAGATTGTGG + Intronic
1066248442 10:33608638-33608660 GAGTAGGTAAATGTAAAATGGGG + Intergenic
1068089887 10:52420649-52420671 GAGTGGGCCAAGATAACTTTGGG + Intergenic
1070321361 10:75357187-75357209 GAGTGGGTCAAGACAAGTAGAGG + Intergenic
1071893507 10:90039127-90039149 TTGCGGGTCAATATAAATTCAGG - Intergenic
1072844068 10:98809078-98809100 GAGTGAGTCAATGTCAATTGGGG - Intronic
1073086910 10:100897038-100897060 AGCTGGGTCAATATAAAATGTGG - Intergenic
1076200558 10:128554441-128554463 GGGTGGGTTAATGTAAACTGAGG + Intergenic
1077557806 11:3234284-3234306 GAGTGGGACAATTAAAACTGTGG - Intergenic
1078288286 11:9980541-9980563 TAGTGGTTCATTATAAATTCTGG - Intronic
1079721680 11:23822682-23822704 GAGTGGGTAATTATAAATCATGG - Intergenic
1080278299 11:30527501-30527523 GAGTGGGTCAGAATAAAGAGGGG + Intronic
1083915721 11:65742395-65742417 GCGTGAGTCAATTCAAATTGAGG + Intergenic
1087444327 11:98228704-98228726 GAGTGGGGCACTAAAAATTTGGG + Intergenic
1087964897 11:104400096-104400118 GTGTGCTTCAATATAAAATGGGG - Intergenic
1093365335 12:18289006-18289028 GAGTGTGTGAATATAACTTATGG - Intronic
1093777106 12:23088767-23088789 GAATGGGTTAAAAAAAATTGTGG - Intergenic
1094235384 12:28159617-28159639 CAGTATGTCAATATAAGTTGTGG - Intronic
1094475959 12:30840744-30840766 GGATGGGTCAATGCAAATTGAGG + Intergenic
1096730478 12:53607541-53607563 GAATGGATAAATATAAATTAAGG + Intronic
1099009049 12:77269661-77269683 AATTGTGTCAAAATAAATTGTGG - Intergenic
1100428967 12:94513314-94513336 GACTGGGTGGCTATAAATTGGGG - Intergenic
1100440862 12:94615867-94615889 GAGTGTGTAAATATGTATTGTGG - Intronic
1101708132 12:107240021-107240043 GAGTGGGAGAAGATAAATTCAGG + Intergenic
1104477106 12:129079742-129079764 GATTGGGACAATTTAAATGGTGG + Intronic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1109256963 13:60095430-60095452 GGGTGGGTCAATGTAAATTAAGG + Intronic
1109912882 13:68939638-68939660 CAATTGGTCAATATAACTTGGGG + Intergenic
1111179599 13:84645781-84645803 GGGTGGATCAATGCAAATTGAGG + Intergenic
1112022133 13:95380718-95380740 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1112583574 13:100697167-100697189 GAGTGGGTTAATGCAAATTTGGG + Intergenic
1112999892 13:105622438-105622460 GATTGGGTCATTGTAAATTCAGG - Intergenic
1113471040 13:110546542-110546564 GAGTGCATCAATAAAAAATGAGG - Intronic
1118009267 14:61592694-61592716 GAATGGCTCAAGATAAATTTCGG - Intronic
1119468498 14:74878483-74878505 GAGTTTATGAATATAAATTGTGG - Intergenic
1122673304 14:103388894-103388916 GAGTGGATTAAAAAAAATTGTGG - Intronic
1124703296 15:31936404-31936426 TAGTGGGTCTATTTAAATAGTGG + Intergenic
1126174506 15:45722932-45722954 GAGTGGGTCATTATAAAGGGAGG + Intergenic
1126713374 15:51485563-51485585 CAGTGTGTCATTAAAAATTGAGG - Intronic
1128930043 15:71696323-71696345 GAGTGGGTTGTTATAAAGTGAGG - Intronic
1129529520 15:76252353-76252375 GAGTGTGTAAATAAAAATTCTGG - Intronic
1132109823 15:99094517-99094539 GAGTTGATCAATATGTATTGAGG + Intergenic
1135866950 16:26112048-26112070 GAGTTTATAAATATAAATTGTGG - Intronic
1138792099 16:59917906-59917928 GAGAGAGTCAAGCTAAATTGGGG - Intergenic
1138809568 16:60132804-60132826 AAGTGAGTAAATATAGATTGAGG - Intergenic
1140111116 16:72006019-72006041 GATTGTGTCAATAGCAATTGAGG + Intergenic
1140300585 16:73753476-73753498 GAGTGGGTTAAAGTAAATTGAGG - Intergenic
1140309660 16:73836872-73836894 GAGTGGGTTGTTATAAAGTGAGG + Intergenic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1144424856 17:15132285-15132307 GGGTGGGTCAATTCAAATTGAGG - Intergenic
1152042154 17:77910264-77910286 GAGGGGGGCTATACAAATTGGGG + Intergenic
1155523941 18:26697561-26697583 GGGTGGGTCAATGCAATTTGAGG + Intergenic
1155847564 18:30728685-30728707 GAGTGGGACAATACACATTGGGG - Intergenic
1156824624 18:41415638-41415660 AAGTGGGTCAATATGAATGAAGG - Intergenic
1157250131 18:46088230-46088252 GATTGTGTCAATAGCAATTGAGG + Exonic
1158477026 18:57789448-57789470 AAGTGGGTCAATATAACATGTGG + Intronic
1158841364 18:61391881-61391903 GATTGGGTCAAGAAATATTGAGG - Intronic
1159108474 18:64029312-64029334 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1159246992 18:65819232-65819254 GAGTGGGTCAATGCAGATTGAGG - Intronic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1163544088 19:17930673-17930695 GAGGAGGTGAATATAAAGTGAGG - Intergenic
1166160375 19:40948385-40948407 AAGTGGGTCATTATACACTGTGG + Intergenic
1167677895 19:50899713-50899735 TAATGGGTCAATGTAAATTGAGG + Intergenic
926804589 2:16695319-16695341 GAGTGGATAAATAGAAAATGTGG - Intergenic
927078950 2:19609010-19609032 GTGTGGTCCAAAATAAATTGAGG + Intergenic
930863709 2:56102497-56102519 GGGTGGGCCAATGCAAATTGAGG - Intergenic
932261451 2:70330976-70330998 AAGTGTATCATTATAAATTGGGG + Intergenic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
935558945 2:104541273-104541295 GAGTGGGTCATTATCCCTTGGGG + Intergenic
935601147 2:104922668-104922690 AAGTGGGCCAACATACATTGTGG + Intergenic
936237185 2:110752807-110752829 GCGTGAGACAATATATATTGGGG - Intronic
936500774 2:113064516-113064538 GAGTGAGCCAAGATAGATTGGGG - Exonic
942351666 2:175058931-175058953 GAGAGAGTAACTATAAATTGGGG - Intergenic
944062200 2:195582012-195582034 GGGGGGGTCAATAAAAATTTTGG - Intronic
1170478788 20:16744448-16744470 GGGAGGCTCAATACAAATTGAGG + Intergenic
1173236776 20:41253487-41253509 GAGTGAGTCACTTTAAATTCTGG + Intronic
1173891978 20:46519782-46519804 GAGTGGATCAATGCAAATTGAGG - Intergenic
1177584585 21:23073894-23073916 GAGTGGAACAACATACATTGGGG + Intergenic
1180738125 22:18034041-18034063 GAGTGGGTGAATATTAATCTAGG - Intergenic
1181310360 22:21941377-21941399 GAGTCGGGCAGTATAAATGGAGG + Intronic
1182110936 22:27722892-27722914 GAGTGGGTAAAGAGAAATTGAGG + Intergenic
951814322 3:26736717-26736739 GAGAAGTGCAATATAAATTGGGG - Intergenic
951922601 3:27872728-27872750 GAGTGGCCCGTTATAAATTGAGG - Intergenic
953697206 3:45169483-45169505 GAGTGGGTGAAAAGAAATTGCGG + Intergenic
955043841 3:55341341-55341363 GAGTGGGTCAATAAAAAGCAAGG + Intergenic
962300218 3:134234024-134234046 CAGTGGTTGAATATAAATAGTGG + Intronic
966316934 3:178657841-178657863 AAGTGGGTTATTATAAAGTGAGG - Intronic
969091831 4:4699999-4700021 GAGTGGGACTATAAAAAATGAGG + Intergenic
970951774 4:21765027-21765049 GAGTAGCTCAATTTAATTTGGGG - Intronic
970995856 4:22267045-22267067 GGGTGGGTTATTATAAAGTGAGG + Intergenic
974836422 4:67256658-67256680 GGGTGGGTCAATGCAAATTAAGG + Intergenic
977521072 4:98084328-98084350 GAATGGATAAACATAAATTGTGG - Intronic
979410536 4:120373174-120373196 GAACGGGTCAATATAAATGCTGG + Intergenic
982371892 4:154642715-154642737 GAGTGGGTCAATATAAATTGAGG - Intronic
984443738 4:179806687-179806709 GAGTAGGTCAATAACAAGTGAGG + Intergenic
992653706 5:78887311-78887333 GAGTGGGTTGTTATAAAGTGAGG - Intronic
993733410 5:91448229-91448251 GAGTGGATTAAAATAAACTGTGG + Intergenic
993950401 5:94167895-94167917 AATTAGGTCAAAATAAATTGTGG - Intronic
995907097 5:117137798-117137820 GCCTGGGTCAATATAAATCATGG - Intergenic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
997405971 5:133647088-133647110 GAGCGGCCCAATGTAAATTGTGG + Intergenic
1003453213 6:6256623-6256645 GAGTGGGCCAAGAAAATTTGGGG + Intronic
1006045531 6:31293107-31293129 GGATGGTTAAATATAAATTGAGG + Intronic
1008849284 6:56005327-56005349 GATTGGGTCCATGTAAATTATGG - Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1013262189 6:108455279-108455301 GAGTGGGTGATTTTACATTGGGG + Intronic
1015309736 6:131753388-131753410 AAGTGGGTAAACATATATTGTGG + Intergenic
1017501664 6:155031280-155031302 GAATGAGTCAATATAAATCCAGG + Intronic
1018415618 6:163599998-163600020 GAGCGGGTCAATGTAAAGTGAGG - Intergenic
1018531394 6:164767461-164767483 GAATGGGTACATATAAATTCAGG + Intergenic
1021205574 7:17775775-17775797 GAGTGAGTCAACATGAAGTGAGG - Intergenic
1021391858 7:20102641-20102663 GGGTGGGACAAGATAAATTAGGG + Intergenic
1023465982 7:40455544-40455566 GAGTGGGGCTATATTAATTATGG + Intronic
1024241053 7:47436369-47436391 GACTGAGTCAACATAAGTTGTGG - Intronic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1031445809 7:121852285-121852307 GAGAGGAACAATATACATTGGGG + Intergenic
1035903599 8:3485170-3485192 CTGTGGGTGAATATAAACTGTGG + Intronic
1038375206 8:27033164-27033186 GGGTAGGTTAATATGAATTGAGG + Intergenic
1042106777 8:65335966-65335988 AAGTGGTTAAATATAAATTATGG + Intergenic
1043993371 8:86782700-86782722 GAGAGGGTGGATATAAATTTTGG + Intergenic
1045409933 8:101906723-101906745 GAGTGGGTCAAGAGAAAATAAGG + Intronic
1046269938 8:111881722-111881744 GAGTGAGGCAATATAAGTAGAGG - Intergenic
1046360435 8:113146653-113146675 GAGTGGGTAAATAATAAATGTGG + Intronic
1047323088 8:123807554-123807576 GAGTGAGTCAGTATACAGTGTGG + Intronic
1048661906 8:136614146-136614168 GAGAGGGTGAATATCAATCGTGG - Intergenic
1050991356 9:12156840-12156862 GAGTGTTGCATTATAAATTGAGG - Intergenic
1051989186 9:23130337-23130359 GGGTATGTCTATATAAATTGTGG - Intergenic
1056684650 9:88749507-88749529 GAGTTGGTCAACATGACTTGGGG - Intergenic
1061948569 9:133922367-133922389 GAGTGGGGCAATTTAAATGTAGG + Intronic
1189532099 X:41895747-41895769 CAGTGGGGGAATCTAAATTGAGG + Intronic
1194023381 X:88721969-88721991 GACTGGTTCCATATAAATTTTGG + Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1195502911 X:105623702-105623724 GAATGGGTCACTATAACTTAGGG - Intronic
1196995226 X:121374870-121374892 GCGTGTGCCAATAAAAATTGAGG - Intergenic
1197991029 X:132317560-132317582 GATTGGGTGCATATAAATTTAGG + Intergenic
1198255248 X:134918760-134918782 GAGAAGGGCATTATAAATTGAGG - Intergenic
1198408499 X:136340644-136340666 GGGTGTTTCCATATAAATTGAGG + Intronic