ID: 982372068

View in Genome Browser
Species Human (GRCh38)
Location 4:154644752-154644774
Sequence CTGGTAACCCAGGTCTACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 87}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
982372059_982372068 26 Left 982372059 4:154644703-154644725 CCATACCATTTATACGAGCATGT 0: 1
1: 0
2: 0
3: 2
4: 48
Right 982372068 4:154644752-154644774 CTGGTAACCCAGGTCTACCAGGG 0: 1
1: 0
2: 0
3: 13
4: 87
982372063_982372068 -4 Left 982372063 4:154644733-154644755 CCCTAAGAGATAGAGGAGTCTGG 0: 1
1: 0
2: 0
3: 11
4: 132
Right 982372068 4:154644752-154644774 CTGGTAACCCAGGTCTACCAGGG 0: 1
1: 0
2: 0
3: 13
4: 87
982372061_982372068 21 Left 982372061 4:154644708-154644730 CCATTTATACGAGCATGTGTGGA 0: 1
1: 0
2: 0
3: 5
4: 57
Right 982372068 4:154644752-154644774 CTGGTAACCCAGGTCTACCAGGG 0: 1
1: 0
2: 0
3: 13
4: 87
982372065_982372068 -5 Left 982372065 4:154644734-154644756 CCTAAGAGATAGAGGAGTCTGGT 0: 1
1: 0
2: 1
3: 12
4: 119
Right 982372068 4:154644752-154644774 CTGGTAACCCAGGTCTACCAGGG 0: 1
1: 0
2: 0
3: 13
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982372068 Original CRISPR CTGGTAACCCAGGTCTACCA GGG Intronic
903261665 1:22134874-22134896 CTGGGAACCCAGGACTAAGAGGG - Intronic
905039807 1:34946661-34946683 CTCATAACCCATGTCTCCCAGGG + Intergenic
905835172 1:41113128-41113150 GTAAAAACCCAGGTCTACCAGGG - Intronic
905879292 1:41453192-41453214 CTGGTAACCCAGATCTATCTGGG + Intergenic
910899992 1:92110076-92110098 CTCATAACACAGGTCTTCCAAGG + Intronic
918140061 1:181712698-181712720 ATGGTAACTCAGGCTTACCATGG + Intronic
919638743 1:200029429-200029451 CTGGAAACACAGTTCTTCCAGGG - Intronic
924438906 1:244070544-244070566 CAGGAAAGCCAGGTCTCCCAGGG - Intergenic
1063189245 10:3678512-3678534 CTGGTGACCCAGGACCACCCAGG + Intergenic
1074580492 10:114714372-114714394 CTGGTGACCCAGGAGTGCCATGG - Intergenic
1076081007 10:127580603-127580625 CTGGCATCCCAGGTCTTCCCCGG + Intergenic
1078170455 11:8925452-8925474 TTGGGAAGCCAGGTATACCAGGG - Exonic
1084759066 11:71256829-71256851 CAGTTACCCCAGGTCAACCAAGG - Intergenic
1085621469 11:78041049-78041071 CTGGTAAGCCAGGTTGACCCAGG + Intronic
1089439208 11:118500975-118500997 CTGTTTACCCAGGTGTTCCAGGG + Exonic
1090683628 11:129089622-129089644 CTGCTTACCGAGGTCTACGAGGG - Intronic
1092946489 12:13458733-13458755 CTGGAAACCCAGGTCCAAGATGG - Intergenic
1093926066 12:24909607-24909629 CTGGTAACCCAGGTGTTTCTTGG + Intronic
1100108005 12:91201367-91201389 ATGATAATCAAGGTCTACCATGG - Intergenic
1100225417 12:92551351-92551373 CTGGGAAGCCAGGTCTACTATGG + Intergenic
1100772507 12:97939001-97939023 TTGATAACCCAGGAATACCATGG - Intergenic
1101285425 12:103306975-103306997 CTGGTAGCCCAGGTGTTCCTTGG - Intronic
1112620793 13:101051997-101052019 CTGGTAGCCCAGGTGTCCCTTGG + Intergenic
1113933488 13:113981017-113981039 GTGGGTACCCAGGTCCACCATGG - Intronic
1116220452 14:42079187-42079209 TTAGTAACCCAGGTCTTCCTAGG - Intergenic
1118904251 14:70011972-70011994 CTGGTGACACAGGACGACCATGG + Intronic
1121403470 14:93703225-93703247 CTGGCTTCCCAGGACTACCAAGG + Intronic
1127581363 15:60341894-60341916 CTGGAAACCCAGCTCTCCCAGGG + Intergenic
1129296668 15:74603727-74603749 GTGGGAGCCCAGGTCTGCCAAGG - Intronic
1133244833 16:4441330-4441352 TGGGCATCCCAGGTCTACCAAGG - Intronic
1134083655 16:11341717-11341739 CAGGTAACCCTGGTGTAGCAGGG - Intronic
1137654302 16:50146968-50146990 CTGGCAAACTAGGTCCACCAGGG + Intergenic
1141858684 16:86701837-86701859 ATGGGAACCCAGGTCTCCCCAGG - Intergenic
1142938977 17:3365318-3365340 CTGGTGACCCAGGACTTCCAGGG + Intergenic
1143573694 17:7777305-7777327 CTGGTAATTCTGCTCTACCACGG - Intronic
1144506435 17:15835181-15835203 CTGGTTATTCAGGGCTACCATGG - Intergenic
1144810635 17:17996730-17996752 CTGGTGACCCAGGTTTGCCTTGG + Intronic
1145170611 17:20653114-20653136 CTGGTTATTCAGGGCTACCATGG - Intergenic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1147939504 17:44036312-44036334 CAGGCAACCCAGGTCAACAAAGG + Intronic
1151730136 17:75906190-75906212 CTTGTGATCCAGTTCTACCATGG + Intronic
1153643067 18:7172280-7172302 CTGGAGACACAGGGCTACCAGGG + Intergenic
1155054271 18:22170873-22170895 CTGGTATCCCAGCCCTTCCAGGG + Intronic
1160222104 18:76985068-76985090 CTGCTCCCCCAGGTCTACCAGGG + Intronic
1166068275 19:40373075-40373097 CAGGCAACCCAGGTCTCCCTAGG + Intronic
926309619 2:11666102-11666124 TTGGTACCTCAGCTCTACCAAGG - Intronic
926679549 2:15653244-15653266 CTGGGAACCCAGGTCCACCGAGG + Intergenic
929781525 2:44960372-44960394 CTGCAAACCCAGGCCTACCCTGG + Intergenic
931106351 2:59060878-59060900 CTGGAAACTCAGGTAAACCAGGG - Intergenic
932930064 2:76025056-76025078 CTGGGAATCCAGGTGTTCCAGGG - Intergenic
935247476 2:101231751-101231773 CTTGTAACCCAGGTGTTCCCTGG + Intronic
939129579 2:138218401-138218423 CTGTGAACCCAGGTTTAGCAAGG + Intergenic
939598887 2:144163841-144163863 CAGACTACCCAGGTCTACCATGG + Intronic
942035132 2:172003353-172003375 CTGGAATCCCAGGTCTAGCTCGG + Intronic
942220400 2:173763396-173763418 CTGGCAACCCAGGCCTTCCATGG + Intergenic
943523467 2:188985699-188985721 CTGGTATTCCAGGACAACCAGGG + Exonic
947168175 2:227283827-227283849 CTGGGAACCCAGGCACACCAGGG + Exonic
947334050 2:229062415-229062437 CTTGTAACCCAGGAATACAAGGG + Intronic
948902395 2:240963244-240963266 CTGGTAAGCAAGGCCTACCTGGG - Intronic
1170768188 20:19309854-19309876 CTGGAAGCCCAGCTCTCCCAGGG - Intronic
1171183823 20:23110784-23110806 CTGGAAACCCAGGTGTCCCTGGG + Intergenic
1173015502 20:39221458-39221480 CAGGTAACCCAGGTGGGCCAAGG + Intergenic
1173941105 20:46912243-46912265 CTGCTAACCGTGGTCTACCATGG + Intronic
1174660202 20:52205780-52205802 CTTGGAAACCAGGTCTACCATGG - Intergenic
1175105237 20:56610327-56610349 CTGGCCACCCAGGTCTGCCCAGG - Intergenic
1183564960 22:38607685-38607707 CTGGGGACCCAGGGCAACCAGGG + Intronic
1184255816 22:43286281-43286303 CTGGAACCCCAGCTCTACCATGG - Intronic
1184268629 22:43364613-43364635 CTTCTCACCCAGGTCTACAAAGG + Intergenic
1184322650 22:43754346-43754368 ATGGAAACCCAGGTCTGCCCGGG + Intronic
950173656 3:10856572-10856594 ATTTAAACCCAGGTCTACCAAGG + Intronic
950195974 3:11009542-11009564 CTGGTGCACCTGGTCTACCATGG - Intronic
952413840 3:33072865-33072887 TTGCTAAGCCAGGTCCACCAGGG + Intronic
954919587 3:54178391-54178413 TTGGTAACTCTGGTCTCCCAAGG + Intronic
961338245 3:126198450-126198472 CTAGTCATCCAAGTCTACCAAGG - Intergenic
961651959 3:128421193-128421215 CTGGTAACCCTGCCCTGCCAGGG - Intergenic
980454985 4:133027819-133027841 ATGGTAATCCATGTATACCATGG + Intergenic
981276612 4:142906041-142906063 TTGGTAACACAGATATACCAAGG - Intergenic
982372068 4:154644752-154644774 CTGGTAACCCAGGTCTACCAGGG + Intronic
986510956 5:8505670-8505692 CTGTTAGCTCAGGCCTACCAGGG + Intergenic
992293012 5:75299679-75299701 CTTGTAGGCCAGGTCTAGCATGG - Intergenic
993137952 5:83993855-83993877 CTGTATACCCAGGTCTTCCAAGG + Intronic
994069503 5:95584386-95584408 CTGGTAACTGAAGTCTACCGGGG + Intronic
998481562 5:142467403-142467425 CTGCTGACCCTTGTCTACCAAGG - Intergenic
1005948523 6:30613714-30613736 ATGGGAAGCCAGGTCTACTAGGG - Intronic
1012385049 6:98671004-98671026 CAGGTAATCCAGGTCAACAAGGG + Intergenic
1014313388 6:119832633-119832655 ATGGTACACCAGGTCTACTAAGG - Intergenic
1019526322 7:1482044-1482066 CTGGAAACCCATGACTGCCAAGG - Intronic
1023273518 7:38493161-38493183 CTGTTAACGCAGGTTTTCCAAGG + Intronic
1028528743 7:91814720-91814742 TTGGTAACCCAGGTGTTCCTTGG - Intronic
1028745348 7:94320701-94320723 CTGGGAACCCAGGCCTATGATGG + Intergenic
1028872438 7:95784206-95784228 CTGGTAATTCAGGTCTATCGGGG + Intronic
1030365441 7:108640594-108640616 CTGGTAACATAGGTATACAATGG - Intergenic
1033583764 7:142759482-142759504 ATCGTAACCCAGGTTTACCATGG + Intronic
1045000110 8:97871022-97871044 CAGGCAACCCAGGGCCACCAAGG + Intronic
1049616133 8:143576515-143576537 CCGGTAGCCCAGCTCTCCCAGGG + Exonic
1050224025 9:3429974-3429996 CTGGTAACCTAAGTCAACTAAGG - Intronic
1052712133 9:32069823-32069845 CTGGTAACACAGGTCTCCTAAGG + Intergenic
1052900942 9:33794631-33794653 ATGGTAACCCAGATTTACCATGG + Intronic
1055086117 9:72315749-72315771 CTGGTAACCCGGGTCAGGCAAGG - Intergenic
1061130318 9:128704509-128704531 CTGATTACCCAGGGCTGCCAGGG + Intronic
1198698451 X:139369449-139369471 TTGATAAATCAGGTCTACCAGGG - Intergenic