ID: 982375969

View in Genome Browser
Species Human (GRCh38)
Location 4:154690977-154690999
Sequence CCATAGCCACATGTGGTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1176
Summary {0: 1, 1: 4, 2: 35, 3: 221, 4: 915}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
982375969 Original CRISPR CCATAGCCACATGTGGTGAG TGG (reversed) Intronic
900072456 1:782415-782437 CAACAGCCACATGTGGCAAGTGG + Intergenic
901144892 1:7058095-7058117 CCATAGCCATCTGGTGTGAGGGG - Intronic
901715871 1:11153696-11153718 CAGTAGCCACATGTGGCCAGTGG - Intronic
901728461 1:11261116-11261138 CCACAGCCACATGTGGCTGGTGG + Intronic
901890738 1:12261572-12261594 CAGTAGCCACATGTGGTTAGTGG + Intronic
902246054 1:15121249-15121271 CTATAGCTACATGTGGCTAGTGG + Intergenic
902354925 1:15890974-15890996 CAATAGCCACATGTGACTAGTGG + Intronic
902655428 1:17864553-17864575 TAATAGTCACAAGTGGTGAGTGG - Intergenic
902700968 1:18171772-18171794 CCATATCCACATGGGGGAAGGGG - Intronic
902729323 1:18358489-18358511 CCCCAGCCACATGGGGTGAGTGG + Intronic
903240517 1:21979776-21979798 CAATAGTCACATGTGGCTAGTGG + Intronic
903244259 1:22004395-22004417 CAATAGTCACATGTGGCTAGTGG + Intronic
903347504 1:22696403-22696425 TGATAGCCACATGTGGCCAGTGG + Intergenic
903593223 1:24473097-24473119 CAACAGCCACCTGTGGAGAGTGG - Intergenic
904129433 1:28264639-28264661 AAATAGCCACATGTAGTGAGGGG - Intronic
905386787 1:37610213-37610235 CAATAACCACATGTGGTGAGCGG - Intergenic
905712788 1:40120878-40120900 AGATAGCCACATGTGGCCAGTGG + Intergenic
905841963 1:41188442-41188464 AAATAGCCACATGTGGCTAGTGG - Intronic
905930610 1:41784195-41784217 CAATAGCCACAAGTGGCTAGTGG - Intronic
905944151 1:41887936-41887958 TAATAGCCACATGTGGCCAGTGG + Intronic
906369446 1:45240384-45240406 CAATTCCCACATGTTGTGAGAGG - Intronic
907084043 1:51652718-51652740 CAATAGCCACATGTGACTAGTGG + Intronic
907160361 1:52365046-52365068 TAACAGCCATATGTGGTGAGGGG + Intronic
907238313 1:53066515-53066537 CAGTAGCCACATGTGGCCAGTGG + Intronic
907345603 1:53776329-53776351 CAATAGCTACATGTGGCTAGTGG - Intronic
907872811 1:58458207-58458229 CAATAGCCACATGTGGCTAGTGG + Intronic
908018513 1:59874185-59874207 CAATAGCCACATGTGGCTAGTGG + Exonic
908103211 1:60812520-60812542 CAATAGCTACATGTGGTTACTGG - Intergenic
908296042 1:62714142-62714164 CAATAGCCACATGTGCCTAGTGG - Intergenic
908430093 1:64048218-64048240 AAATAGCCACATGTGGCTAGTGG - Intronic
908678887 1:66636579-66636601 TCATAGCCACTTGTGGCTAGTGG + Intronic
909476233 1:76084047-76084069 CAAAAGCCACATGTGGCTAGTGG + Intronic
909539374 1:76773586-76773608 AAATAGCCACATGTGGCTAGTGG - Intergenic
909842117 1:80340576-80340598 ATATAGCCACATGTAGTTAGTGG + Intergenic
910113386 1:83705295-83705317 TCATAGCCTCATGTGGCCAGTGG - Intergenic
910164038 1:84304403-84304425 TCGTAGCCACATGTGGCTAGTGG - Intronic
910483240 1:87681781-87681803 CAATGGCCACATGTGGCTAGTGG - Intergenic
910544347 1:88397223-88397245 CAATAGCCACATGTGGCTAGTGG - Intergenic
910655397 1:89613214-89613236 GAATAGCCACATGTGGCTAGCGG - Intergenic
910932517 1:92456885-92456907 CAATAGCCAAATGTGGCTAGTGG + Intergenic
911108195 1:94154445-94154467 CCATAGCCACATGTGGCTGGTGG - Intronic
911143919 1:94534542-94534564 CAACAGCCACATGTGGCTAGTGG + Intronic
911263424 1:95714937-95714959 CAATAGCCACATGTGTCTAGTGG + Intergenic
911641695 1:100296720-100296742 CGAGAGCCACATGTGGCTAGTGG - Intergenic
911701954 1:100963700-100963722 CACTAGCCACATGTGGTTTGTGG - Intronic
911959820 1:104287231-104287253 CATTAGCCAGATGTGGTGACAGG + Intergenic
911970993 1:104437608-104437630 CAGTAGCCACATGTGGCTAGTGG - Intergenic
913679787 1:121178856-121178878 CAACAGCCACATGTGGCTAGTGG - Intronic
914031622 1:143966506-143966528 CAACAGCCACATGTGGCTAGTGG - Intronic
914157823 1:145101459-145101481 CAACAGCCACATGTGGCTAGTGG + Intronic
914912403 1:151798227-151798249 CAATAGCCACATGTGGCCAATGG - Intergenic
914919762 1:151838978-151839000 CAAGAGCCACATGCGGTGGGTGG + Exonic
915122599 1:153640126-153640148 CAATAGCCACATGTGACTAGTGG - Intronic
917339511 1:173960538-173960560 CAACAGCCACATGTGGCTAGTGG + Intronic
917344437 1:174014398-174014420 ACATAGCCACATATAGTTAGTGG + Intronic
917947882 1:179995141-179995163 CAATAGCCATATGTGGCTAGTGG + Intronic
918217959 1:182409447-182409469 AAATAGCCACATGTGGTTAGTGG - Intergenic
918941008 1:190996749-190996771 CAATAGCCACATGTGGCTAATGG - Intergenic
919116783 1:193289935-193289957 CCATAGCCACATGTGTCTAGTGG + Intergenic
919437762 1:197584433-197584455 CAATGGTCACATGTGGTTAGTGG + Intronic
919729586 1:200904447-200904469 CCATAGCCACATGCAGCGAGTGG - Intronic
920127499 1:203705036-203705058 CAGCAGCCACATGTGGTGAGTGG - Intronic
920467097 1:206197392-206197414 CAACAGCCACATGTGGCTAGTGG - Intronic
920696358 1:208184000-208184022 CAATAGCCACATGTAGCTAGTGG + Intronic
920860466 1:209701435-209701457 CAATTTCCACATGTTGTGAGAGG - Intronic
921102140 1:211937703-211937725 CAATAGCTACATGTGGCCAGTGG + Intergenic
921369410 1:214406155-214406177 CCATAGCCGCATGTGTCTAGAGG - Intronic
921504192 1:215946679-215946701 CAATAGCCATATGTGGATAGGGG - Intronic
921718602 1:218445671-218445693 CAATGGCCACATGTGGCTAGTGG - Intergenic
921719707 1:218457059-218457081 CAGTAGCCACATGTGGCTAGTGG + Intergenic
921947675 1:220897328-220897350 CAATAGCCATATGTGGCTAGTGG + Intergenic
922005456 1:221526140-221526162 GAATAGCCACACATGGTGAGTGG + Intergenic
922026352 1:221752918-221752940 AAATAGCCACATGTGGCTAGTGG - Intergenic
922267397 1:223996374-223996396 CAACAGCCACATGTGGCAAGTGG + Intergenic
922482829 1:225950947-225950969 CCATACCCAGAAGTGGGGAGGGG + Intergenic
922924063 1:229332788-229332810 CAATACCCACATGTGGCTAGTGG + Intronic
923282607 1:232459281-232459303 TAATAGCCACATGTGGTTTGTGG + Intronic
923647315 1:235837076-235837098 CAAAAGCCACATGTGGCTAGGGG + Intronic
924217278 1:241836330-241836352 CAATAGCCACATGTGGTTAGTGG - Intergenic
1063088834 10:2843267-2843289 CAATAGCCCCATGAGGTGAGTGG + Intergenic
1063631525 10:7738737-7738759 CCACCCCCACATGTGATGAGAGG + Exonic
1063683680 10:8214810-8214832 ACCTAGCCACATGTGGCAAGTGG + Intergenic
1064231530 10:13533011-13533033 CCATAGTCACATGTAGTTACAGG + Intergenic
1064330195 10:14386552-14386574 AGGTAGCCACATGTGGTTAGTGG - Intronic
1064337619 10:14458074-14458096 CAATTCCCACATGTGGTGGGAGG + Intronic
1064554541 10:16535254-16535276 CAATAGCCACATGTGACTAGTGG - Intergenic
1064806131 10:19135626-19135648 CAATAGCCTCATGTGATCAGTGG - Intronic
1065139284 10:22704847-22704869 CACTAGCCACATGTGGTTAGTGG - Intronic
1065155607 10:22867377-22867399 CAATAGCTACATGTGGTTGGTGG + Intergenic
1065198004 10:23285862-23285884 CAATAGCCACATGTGGCCAAGGG + Intronic
1065348646 10:24774454-24774476 CAGTAGCCACATGTGGCTAGTGG - Intergenic
1065873597 10:29977868-29977890 CAACAGCCACATGTGGCCAGTGG + Intergenic
1065888156 10:30097237-30097259 AAATAGCCACATGTGGCTAGTGG + Intronic
1065996599 10:31065169-31065191 CCAAAGCCACAGGTGTTAAGTGG - Intergenic
1066102593 10:32131241-32131263 CCATAGTCACATATGATTAGTGG + Intergenic
1066536651 10:36399187-36399209 CCTTAGCCTGATGTGGTGAATGG - Intergenic
1066611502 10:37253272-37253294 CAATAGCCACATGTGGCTAGTGG - Intronic
1067509067 10:46880161-46880183 CAATAACCACATGTGGCAAGTGG - Intergenic
1067653184 10:48171689-48171711 CAATAACCACATGTGGCAAGTGG + Intronic
1068416952 10:56735177-56735199 CAATTCCCACATGTTGTGAGAGG - Intergenic
1068968760 10:62940369-62940391 CTATAACCACATGTGGCTAGGGG - Intergenic
1069320943 10:67170844-67170866 CAATAGCGACATGTGGCCAGTGG - Intronic
1069386922 10:67892061-67892083 CAACAGCCACATGTGGCTAGTGG - Intronic
1069736310 10:70657026-70657048 CCATGGCCAGATGTGGTCGGGGG + Intergenic
1069823857 10:71243420-71243442 CAATAGCCACGTGTGGCTAGTGG - Intronic
1070263981 10:74884971-74884993 CAATAGCCACATGTGGCTGGTGG - Intronic
1070532853 10:77352465-77352487 CAATAGCCATGTGTGGTTAGTGG - Intronic
1070577286 10:77688782-77688804 CCATGGCCACAGGTGGCTAGTGG - Intergenic
1070655057 10:78265771-78265793 CCATAGCCTCAGGCAGTGAGGGG - Intergenic
1070794261 10:79207771-79207793 CCCTAGCCACATAAGGTGATGGG - Intronic
1071028788 10:81146778-81146800 CAGTAGCCACATGTGGCTAGTGG - Intergenic
1071775893 10:88787490-88787512 ATATAGCCACATGTGGCTAGTGG - Intergenic
1072099126 10:92212583-92212605 CAATAGCCACATGTGGTTAGTGG - Intronic
1072176450 10:92927579-92927601 CTATAGCCACATGTGACTAGTGG + Intronic
1072552518 10:96489587-96489609 CAATAACCACATGTGGTTAGCGG - Intronic
1072615347 10:97045994-97046016 CCACAGCCACATGAAGTGACTGG + Intronic
1072672670 10:97442459-97442481 CAATAGCCACTTGTGGCTAGTGG - Intronic
1072844331 10:98812694-98812716 CAGTAGCCACATGTGGCTAGTGG + Intronic
1072936699 10:99719972-99719994 CCACAGGCACATGTGGCTAGGGG - Intronic
1073058979 10:100722087-100722109 CAATAGCCACATGTGGCTGGTGG + Intergenic
1073482454 10:103795246-103795268 AAATAGCCACATGTGGCTAGTGG + Intronic
1074567908 10:114597943-114597965 CAGTAGCCACATGTGGTTAGTGG - Intronic
1074589304 10:114797674-114797696 CAATAGCCACATGTGGCTAGTGG - Intergenic
1074644580 10:115432290-115432312 CAATAGCCACATATGGCTAGTGG + Intronic
1074690777 10:116002432-116002454 GCCTAGCCACATGTGGCCAGTGG + Intergenic
1074736319 10:116437834-116437856 CAATAGCCACATGTGGCTAGTGG + Intronic
1075140158 10:119826210-119826232 TCACAACCACATGTGGTGAGTGG - Intronic
1075516261 10:123110960-123110982 TCATCTCCACATGTGGTGGGAGG + Intergenic
1075626701 10:123969104-123969126 ACATAGCGACATGTGGCTAGTGG - Intergenic
1075928185 10:126270542-126270564 AAATAGCCACATGTGGCTAGTGG + Intronic
1076098154 10:127750373-127750395 CAACAGCCACATGTGTTGACAGG + Intergenic
1077466699 11:2736869-2736891 CCACAGTCACAGGTGGGGAGTGG + Intronic
1078105438 11:8355381-8355403 CAATAGCCACATGGGGTTAGTGG + Intergenic
1078506698 11:11955536-11955558 CAATAGCCACATGTGGCTAATGG + Intronic
1078518599 11:12045972-12045994 AAATAGCCACATGTGGCTAGTGG + Intergenic
1078518991 11:12048403-12048425 CGATGGCCACATGTGGCCAGTGG + Intergenic
1078656110 11:13241155-13241177 CCATAGTCGCATGTGGTTAGTGG - Intergenic
1078833869 11:15006491-15006513 CAACAGCCACATGTGGCTAGCGG + Intronic
1078863346 11:15274132-15274154 CCATAGCCTCATGTTGAGATGGG + Intergenic
1078935836 11:15949231-15949253 CAATAGCCACATGTGGCTAGAGG + Intergenic
1079025337 11:16943350-16943372 CCATAGCCACATGTGGTCAGTGG + Intronic
1079634692 11:22721599-22721621 AAATAGCCACATGTGGATAGTGG - Intronic
1079634695 11:22721668-22721690 CAATAGCCACATGTGGCTAATGG + Intronic
1080303210 11:30808173-30808195 CTATAGCCACATGTGGCTATTGG - Intergenic
1080400594 11:31931638-31931660 CAATAGCCACTTGTGGCTAGTGG - Intronic
1080610342 11:33898722-33898744 CAATAGCCACATGGGGCCAGTGG + Intergenic
1080655520 11:34254993-34255015 AAATAGCCACATATGGTTAGTGG + Intronic
1081546067 11:44072759-44072781 CATTAGCCACATGTGGCCAGTGG + Intronic
1081686252 11:45045188-45045210 CAACAGCCATATGTGGTCAGTGG - Intergenic
1082276426 11:50226899-50226921 CAATAGCCACATGTGGCTGGTGG - Intergenic
1082283280 11:50294833-50294855 CAACAGCCACATGTGGCAAGTGG - Intergenic
1082771365 11:57210413-57210435 GCATAGCCACATGTGGCTATTGG + Intergenic
1082776209 11:57246224-57246246 CCATAGCCACACATGGCAAGTGG - Intergenic
1083159472 11:60845930-60845952 ACATAGCCACATGTGGCTGGCGG - Intronic
1083194541 11:61077036-61077058 AAATAGCCACATGTGGCTAGTGG - Intergenic
1084346659 11:68555506-68555528 TGATAGCCACATGTAGTGAATGG + Intronic
1084859705 11:72010457-72010479 CAGTAGCTACATGTGGTTAGTGG - Intronic
1085133069 11:74058897-74058919 CGATAGCCACATGGGGCTAGTGG + Intronic
1085358724 11:75865462-75865484 CAATGGCCACATGTGGCCAGTGG - Intronic
1085427317 11:76416011-76416033 TAATAGCCACATGTGGTTAATGG + Intergenic
1085544751 11:77307158-77307180 TAATAGCCACATGTGGCTAGTGG + Intergenic
1085582773 11:77669619-77669641 CAATAGCCATATGAGGTTAGTGG + Intronic
1085591715 11:77768592-77768614 CAAGAGCCACATGTGGCTAGTGG + Intronic
1085623863 11:78057241-78057263 AAATAGCCACATGTGGTGGTGGG + Intronic
1085743159 11:79094018-79094040 CAATAGCCACATGTGGCTAGTGG + Intronic
1085763892 11:79265355-79265377 CCATAGCCACATGTGGCCAATGG - Intronic
1085783601 11:79431995-79432017 CAACAGCCACATGTGGTTAGTGG - Intronic
1086037501 11:82434499-82434521 CTGTAGCCACATGTGGTTAGTGG - Intergenic
1087023780 11:93629503-93629525 CTATATCCACATGTGGCTAGTGG - Intergenic
1088003428 11:104910484-104910506 TCATAGCTACATGTTGCGAGTGG + Intergenic
1088091152 11:106041431-106041453 CAATAGCCACATGTGGCTAGTGG - Intergenic
1088128783 11:106461923-106461945 AAATAGCCACATGTGGCTAGTGG + Intergenic
1088150695 11:106741330-106741352 CAATAGTCACATGTGGCTAGTGG + Intronic
1088212216 11:107469319-107469341 AAATAGGCACATGTGGTTAGTGG - Intergenic
1088496049 11:110432029-110432051 CAGTAGCCACATGTGGCTAGTGG + Intronic
1088810969 11:113392009-113392031 CCTTAGCCACAGGTGTTCAGGGG + Intronic
1088839581 11:113612988-113613010 CAATAGTCACATGTGGCTAGGGG - Intergenic
1088977533 11:114829226-114829248 CAAGAGCCACATGTGGTTAGTGG + Intergenic
1089437109 11:118478471-118478493 CAATAGCCACATGTGGCTAATGG - Intronic
1089800059 11:121020527-121020549 AAATAGCCACATGTGGCTAGTGG + Intergenic
1089832628 11:121342095-121342117 CAATAGCCACATGTAGCTAGTGG - Intergenic
1089909965 11:122088205-122088227 AAATAGCCACATATGATGAGTGG + Intergenic
1090023112 11:123144944-123144966 CCATTGCCACATGTAGTGGCTGG - Intronic
1090085089 11:123643550-123643572 TCATAGCCACATGTGGCTGGTGG + Intronic
1090112085 11:123923410-123923432 CAATAGCCCTATGTGGTTAGCGG - Intergenic
1090131150 11:124143421-124143443 CAATAGCCACATGTGACTAGTGG - Intronic
1091285607 11:134407073-134407095 CAACAGCCACATGTGGCTAGAGG - Intronic
1091561301 12:1615978-1616000 AAATAGCCACATGTGGTCAGTGG + Intronic
1091957143 12:4655355-4655377 CAGTAGCCACATGTGGCCAGTGG - Intronic
1092227920 12:6760649-6760671 AAATAGCCACATGTGGCTAGTGG - Intronic
1093106592 12:15094939-15094961 CAATTGCCACATGTGGCTAGTGG - Intergenic
1093513182 12:19952868-19952890 GCATGGCCACATGTGGCTAGTGG - Intergenic
1093547391 12:20365238-20365260 CAATGGCCACATGTGGTTAGTGG + Intergenic
1093665045 12:21802636-21802658 TAATAGCCACATGTGGCCAGGGG + Intronic
1094013938 12:25841525-25841547 CAACAGCCACATGTGGCTAGTGG + Intergenic
1094164073 12:27423892-27423914 CAGTAGCCACATGTGGCTAGTGG - Intronic
1094284540 12:28778121-28778143 CAATAGCCACATGTGGCTAATGG + Intergenic
1094485577 12:30923994-30924016 CAGTAGCCACATGTGGCTAGTGG - Intergenic
1095307469 12:40655014-40655036 CTATAGCCACATGTGACTAGTGG + Intergenic
1095643750 12:44517600-44517622 CAATAGCCACATGTGGCTACTGG - Intronic
1095713409 12:45315160-45315182 CCATACCCATGTGTGGTCAGTGG - Intronic
1095948802 12:47769960-47769982 CAATAGCCACCTGTGATTAGTGG + Intronic
1095991100 12:48035153-48035175 CCTCAGCCACATGTGGAAAGGGG + Intergenic
1095995515 12:48080210-48080232 CATTAGCCACATGTGGCTAGTGG - Intronic
1096345124 12:50839573-50839595 AAATTGTCACATGTGGTGAGGGG + Intergenic
1096428656 12:51525145-51525167 CCATAGCCACATGTGGCTAATGG + Intergenic
1097127588 12:56786969-56786991 CAATAGCTACATGTGGCTAGTGG + Intronic
1097484830 12:60183195-60183217 CAATAGCTACATGTGGCCAGTGG + Intergenic
1097688688 12:62714159-62714181 CAGTAGCCACATGTGGCTAGTGG - Intronic
1097760356 12:63458062-63458084 CAATAGCCACATGTGGTTTGTGG - Intergenic
1098607728 12:72413338-72413360 CAATAGTCACATGTGGCTAGTGG - Intronic
1099094922 12:78363113-78363135 CAATAGTCACATGTGGCAAGTGG + Intergenic
1099424740 12:82509013-82509035 CAATAGCCACATGTGGTTTGTGG + Intergenic
1099543280 12:83942149-83942171 CCATAGCCAAATGTGGCTTGTGG + Intergenic
1099853632 12:88137258-88137280 ACATAGCTACATGTAGCGAGTGG - Intronic
1100195777 12:92242618-92242640 AAATAACCACATGTGGTTAGTGG - Intergenic
1100302243 12:93318524-93318546 CAGTAGCCACATGTGGCTAGTGG + Intergenic
1100605831 12:96151244-96151266 CAATAGCCACATGTGGCTAACGG - Intergenic
1100697691 12:97113467-97113489 CAATAGCCTCATGTGGCTAGTGG + Intergenic
1100721215 12:97360747-97360769 CAGTAGCCACATGTGGGTAGTGG + Intergenic
1101129152 12:101671121-101671143 CAACAGCCACATGTGGCTAGTGG - Intronic
1101329171 12:103743625-103743647 CGATAGCCACATGTGCCTAGTGG - Intronic
1101388546 12:104279136-104279158 TAATAGTCACATGTGGTGAGTGG + Intronic
1101806850 12:108071563-108071585 CAATAGCCACGTGTAGTGAAGGG + Intergenic
1101931474 12:109017463-109017485 CAATAGCTACATGTGGCTAGTGG - Intronic
1101974862 12:109348381-109348403 AAATAGCCACATGTGGCTAGTGG + Intronic
1102133964 12:110557143-110557165 CAATAGCCACATGTGGCTAGTGG - Intronic
1102161960 12:110776480-110776502 CCAAAACCCCATTTGGTGAGTGG + Intergenic
1102348819 12:112177075-112177097 CCATAGCCAGTTGTGGTTAGGGG + Intronic
1102368987 12:112365534-112365556 CAATAGCCACATGTGGGTGGTGG + Intronic
1102398485 12:112608262-112608284 AAATAGCCAGATGTGGTGACGGG - Intronic
1102925088 12:116820443-116820465 CCATAGCGACATGTGACCAGTGG + Intronic
1102984178 12:117265193-117265215 CAATAGCCACATGTGGCTGGTGG - Intronic
1103009096 12:117444291-117444313 CAGTAGCCACGTGTGGTCAGTGG + Intronic
1103013835 12:117478787-117478809 ACATAGCCACATCTGGCTAGTGG + Intronic
1103043579 12:117716365-117716387 CTCTAGCCACATGTGGCCAGTGG - Intronic
1103072557 12:117956864-117956886 CAATGGCCACATGTGGCAAGTGG + Intronic
1103331105 12:120154704-120154726 CTTTAGCCACATGCGGTTAGTGG + Intronic
1103331296 12:120155819-120155841 CTTTAGCCACATGCGGTTAGTGG - Intronic
1103357346 12:120331522-120331544 TCATAGACACATGTGGCGAGTGG + Intergenic
1103365443 12:120379225-120379247 CAGTAGCCACACGTGGTGAGTGG - Intergenic
1103403184 12:120657104-120657126 CAATAGCCACATGTGGCTAGTGG - Intronic
1103403191 12:120657197-120657219 ACATAGCCACATGTGGCTAGCGG + Intronic
1103770984 12:123324223-123324245 CAATAGCCACATGTGACAAGCGG + Intronic
1103771504 12:123330204-123330226 CAATAGCCACATGTGATGAGTGG + Intronic
1104002774 12:124870838-124870860 CCATAGCCACATAGGGCCAGTGG - Intronic
1104226276 12:126837719-126837741 CCATAAGCAGATGTGGTGAGAGG - Intergenic
1104264754 12:127220832-127220854 CCAAAGCCCCAGTTGGTGAGAGG - Intergenic
1104946338 12:132416474-132416496 CCATCTCCAGATGTGGGGAGGGG + Intergenic
1106014417 13:25854746-25854768 CAATAGCCACATGTGGCTAATGG - Intronic
1106258905 13:28047016-28047038 CAATAGCCACATGTGGCTGGTGG + Intronic
1107340515 13:39400360-39400382 CAATAGCCACATGTGGCTGGTGG + Intronic
1107340674 13:39401987-39402009 CAATATCCACATGTGGTTAGTGG - Intronic
1107600925 13:42011888-42011910 CCAGAGCCAGATGTGGGCAGTGG - Intergenic
1107670573 13:42742686-42742708 CAATAGCCATAAGTGATGAGTGG - Intergenic
1107858653 13:44639960-44639982 CAATAGCCACATGTGGTTAGTGG - Intergenic
1107883800 13:44857074-44857096 CTGTAGCCACATGTGGCCAGGGG + Intergenic
1108014537 13:46060675-46060697 GGATAGCCACATGTGGTTAGTGG + Intronic
1108031661 13:46237461-46237483 CTATAGGTACATGTGGTGAAGGG + Intronic
1108317046 13:49247257-49247279 CAATAGCCACATGTGGCTGGTGG + Intergenic
1108862339 13:54877072-54877094 CAATAGCTACCAGTGGTGAGTGG + Intergenic
1108931995 13:55836764-55836786 ACATAACCACATGTGGCAAGTGG + Intergenic
1109490838 13:63098173-63098195 CCATAGCCACATGTGACTAGTGG - Intergenic
1109667472 13:65558393-65558415 CAATTCCCACATGTGGTGGGAGG - Intergenic
1110333380 13:74298446-74298468 CCACAGCCACATGTGGCTAGCGG + Intergenic
1110607973 13:77455273-77455295 CAACAGCCACATGTGGATAGTGG + Intergenic
1110781133 13:79466221-79466243 CAATAGCCATATGTGATTAGTGG - Intergenic
1111270343 13:85874007-85874029 CAATAGCCATATGTGGCTAGAGG - Intergenic
1111971402 13:94920846-94920868 AAATAGCCACATGTGGCTAGTGG + Intergenic
1112110651 13:96294485-96294507 CCATAACCACATGTGGCCAGTGG + Intronic
1112255155 13:97823831-97823853 CAGTAGCCACATGTGGCTAGTGG - Intergenic
1112451451 13:99514771-99514793 CAATAGCCACATGTGGCTGGTGG + Intronic
1112509742 13:99998399-99998421 GCATAGCCACATTTGCTGTGCGG + Intergenic
1112571804 13:100600187-100600209 CACTAGCCACATGTGGTGAGTGG + Intergenic
1112591948 13:100771746-100771768 CAGTAGCCACATGTGGTTATGGG - Intergenic
1112591950 13:100771747-100771769 CCATAACCACATGTGGCTACTGG + Intergenic
1112623143 13:101072862-101072884 CCATAACCACATATGGCTAGTGG + Intronic
1112691257 13:101897179-101897201 CTCTAGGCACATATGGTGAGCGG - Intronic
1113188676 13:107718867-107718889 TAATAGCCACATGTGGCCAGGGG + Intronic
1113295918 13:108958672-108958694 ACATAGCCATGTGTGGTTAGTGG + Intronic
1114035398 14:18621775-18621797 CAATAGACACACTTGGTGAGTGG + Intergenic
1114064247 14:19047340-19047362 CAATAGCCACATGTGGCTAGTGG + Intergenic
1114098012 14:19352658-19352680 CAATAGCCACATGTGGCTAGTGG - Intergenic
1114185001 14:20394406-20394428 AAATAGCCACATGTGGCTAGTGG + Intronic
1114194698 14:20467003-20467025 CGATAGTCACATGTGGTTAGTGG - Intergenic
1114419320 14:22567682-22567704 CAATAACCACATGTGGCTAGTGG + Intronic
1114739142 14:25076827-25076849 CCATAGCTTCATGTGGCTAGTGG + Intergenic
1114892133 14:26937990-26938012 CCCTAGCCACATTTGGGAAGCGG - Intergenic
1115178872 14:30598852-30598874 CAACAGCCACATGTGGCTAGTGG - Intronic
1115481093 14:33861907-33861929 CAACAGCCACATGTGGCTAGTGG - Intergenic
1115606383 14:35006383-35006405 CAATAACCACATGTGGCTAGTGG - Intronic
1115610880 14:35047408-35047430 CATTAGCCACATGTGGCTAGTGG + Intronic
1115665625 14:35542278-35542300 CAACAGCCACATGTAGTTAGCGG + Intronic
1115789884 14:36866726-36866748 CCATAGCCACATGGGGCTAGAGG - Intronic
1115997971 14:39213054-39213076 CAATAGTCACATGTGGCTAGTGG - Intergenic
1116411429 14:44627962-44627984 TAATAGCCACATGTGGCTAGTGG - Intergenic
1116850520 14:49904254-49904276 CCATAGCCACATGTGGCTAGTGG + Intergenic
1117081471 14:52156589-52156611 TCATGGCCACATGGAGTGAGTGG + Intergenic
1117302397 14:54442590-54442612 CAATGGCCACATGTGGCTAGTGG - Intergenic
1117323592 14:54648069-54648091 CAATAGCCACATGTGGACAGTGG + Intronic
1117393091 14:55281313-55281335 CAAAGGCCACATGTGGTTAGTGG + Intronic
1117414689 14:55483954-55483976 CAATAGCCACATGTGACTAGTGG - Intergenic
1117618438 14:57558951-57558973 CAATAGCCACATGTGGCTAATGG + Intergenic
1117901349 14:60536928-60536950 CAATAGCCACATGTGGCTACTGG - Intergenic
1117959919 14:61152800-61152822 CAACAGCCACATGTGATAAGTGG + Intergenic
1118143477 14:63110677-63110699 TCATAGCCACAGCTGGTTAGTGG - Intergenic
1118156552 14:63248047-63248069 CAATTCCCACATGTTGTGAGAGG - Intronic
1118295857 14:64568912-64568934 CAGTAGCCACATGTGGCTAGTGG + Intronic
1118453205 14:65922991-65923013 CAGTAGCCACATGTGGCTAGTGG + Intergenic
1118633912 14:67730302-67730324 CAATAGCAACATGTGGCTAGTGG - Intronic
1118888735 14:69889125-69889147 TAATAGCCACATGTGGTTGGTGG + Intronic
1119167647 14:72508426-72508448 CAATAGCCACATGGGGCTAGTGG + Intronic
1119398135 14:74343671-74343693 CCACAGCCACATGTGGCTGGTGG - Intronic
1119420345 14:74504484-74504506 CCACAGCCACATGTGGGCACAGG - Intronic
1120191120 14:81440660-81440682 AAATAGCCACATGTGGTTAGAGG + Intergenic
1120358145 14:83459846-83459868 ACATAACCACCTGTGGTGGGAGG + Intergenic
1120627820 14:86850796-86850818 AAATAGCCACATGTGGCTAGTGG - Intergenic
1120784447 14:88519366-88519388 CAGTAGCCACATGTGGCTAGTGG - Intronic
1120924715 14:89786090-89786112 CAATAGCTGCATGTGGTTAGTGG - Intergenic
1120981554 14:90293575-90293597 AAATAGCCACATGTGGCTAGAGG + Intronic
1121220734 14:92283499-92283521 CAAAAACCACATGTGGTTAGTGG - Intergenic
1122035652 14:98947379-98947401 CCAGGGCCACGTGTGGTGGGTGG - Intergenic
1122333379 14:100945169-100945191 AAATAGCCACATGTGGATAGAGG - Intergenic
1123449372 15:20350401-20350423 CCTTAGCCACATGGTGTCAGGGG - Intergenic
1123492368 15:20791831-20791853 CAATAGCCACATGTGGCTAGTGG - Intergenic
1123548870 15:21360918-21360940 CAATAGCCACATGTGGCTAGTGG - Intergenic
1124368948 15:29092440-29092462 TCAAAGCCACATGTGGGTAGCGG + Intronic
1125076149 15:35620735-35620757 CCACAGCTACATGTGGCTAGTGG - Intergenic
1125447193 15:39770957-39770979 CTGTAGCCACATGTGGCAAGTGG - Intronic
1125753859 15:42049219-42049241 CCAGAGTCACATGTGAAGAGGGG - Intronic
1125843282 15:42825780-42825802 CTATAGCCACATGTAGCTAGTGG + Intronic
1126145181 15:45467099-45467121 CAATAGTCATATGTGGTTAGTGG - Intergenic
1126209360 15:46082342-46082364 TAATAGCCACATGTGGCTAGTGG + Intergenic
1126256506 15:46633047-46633069 CAATAGCCACATGTCTTTAGGGG + Intergenic
1126395890 15:48216953-48216975 CAATAGCCCCATGTGGTTAGTGG - Intronic
1126621221 15:50641849-50641871 ACTTAGCCACGTGTGGTGACGGG + Intronic
1127133992 15:55899787-55899809 CCATAGCTACATGTGATCACTGG - Intronic
1127133998 15:55899884-55899906 CAATAGCCACATGTGGCTACTGG + Intronic
1127159836 15:56170629-56170651 AAATAGCCACATGTGGCTAGTGG - Intronic
1127202354 15:56669501-56669523 CAATAACCACATGTGGCTAGTGG - Intronic
1127312431 15:57764636-57764658 CAGTAGCCACATGTGGTCATTGG + Intronic
1127322981 15:57865594-57865616 ACAGAGCCACATGTGGCTAGTGG + Intergenic
1127370721 15:58337092-58337114 CAATAGCCACATGTGGCTAGTGG + Intronic
1127551878 15:60046471-60046493 CCATAGCCACATGTGTCTAGTGG - Intronic
1127623890 15:60761229-60761251 ACACAGCCACAACTGGTGAGTGG - Intronic
1127823797 15:62684768-62684790 CCAAAGCCAACAGTGGTGAGTGG - Intronic
1127926925 15:63555481-63555503 AAATAGCCACATGGAGTGAGTGG + Intronic
1128077163 15:64834668-64834690 AAATAGCCACATGTGGCTAGTGG - Intergenic
1128077167 15:64834741-64834763 CAATTGCCACATGTGGTTAGTGG + Intergenic
1128140774 15:65299347-65299369 CAATAGCCACATGTGGCCAGTGG - Intronic
1128412042 15:67409350-67409372 CCACAGCCCCCTGTGGTGAGAGG + Intronic
1128417524 15:67460207-67460229 CAATAGCCACATGAGGCTAGTGG + Intronic
1128556746 15:68636902-68636924 CAATAGGCACATGTGGCTAGTGG - Intronic
1129508732 15:76104378-76104400 CCATAGCCACATATGAGCAGGGG + Intronic
1129543023 15:76366741-76366763 CTATAGCCCAAGGTGGTGAGTGG + Intronic
1129900751 15:79147066-79147088 CAATAGTCACATGTGGCTAGTGG + Intergenic
1130352240 15:83102951-83102973 CAACAGCCACATGTGGCTAGTGG - Intergenic
1130528516 15:84727336-84727358 CACGAGCCCCATGTGGTGAGTGG - Intergenic
1130609137 15:85344731-85344753 CCACAGTAACATGTGGAGAGAGG + Intergenic
1130780465 15:87033005-87033027 CAATAGCTACATGTGGCTAGGGG + Intergenic
1131372328 15:91893227-91893249 ACTTAGCCACATGTGGCCAGTGG + Intronic
1131377316 15:91936330-91936352 AAATAGCCATATGTGGTTAGTGG - Intronic
1131617076 15:94027739-94027761 CAAGAGCCATATGTGGTTAGTGG + Intergenic
1131715801 15:95109800-95109822 CAACAGCCACATGTGGCTAGAGG + Intergenic
1132080239 15:98857646-98857668 CCATAGCCACATGTGGCTAGCGG - Intronic
1202957206 15_KI270727v1_random:88152-88174 CAATAGCCACATGTGGCTAGTGG - Intergenic
1132617918 16:851541-851563 CCAAAGACAGATGAGGTGAGGGG + Intergenic
1133091464 16:3407571-3407593 ACATAGTCACATGTGGCTAGTGG + Intronic
1133867306 16:9656151-9656173 CAATAGCAACATGTGGCTAGTGG - Intergenic
1134260332 16:12646106-12646128 CAATAGCCACATGTGGCTATTGG - Intergenic
1134411989 16:14010855-14010877 CAATAGCCACATGTAGTTAGTGG + Intergenic
1134641938 16:15836316-15836338 CAATAGCCACCTGTGGCTAGTGG - Intronic
1134907983 16:17998208-17998230 CAATAGCCACACGTGGCAAGTGG + Intergenic
1135080202 16:19427523-19427545 CCATAGCTACATGTGGCTAGTGG + Intronic
1135171462 16:20187772-20187794 CAACAGCCACATGTGGCTAGTGG + Intergenic
1135251429 16:20903442-20903464 AAATAGTCACATGTGGTCAGTGG - Intronic
1135261896 16:20988293-20988315 CAAGAGCCACATGTGGCTAGTGG + Intronic
1135272374 16:21080549-21080571 CAATGGCCACATGTGGCCAGTGG + Intronic
1135715003 16:24756253-24756275 CGGTAGCCACATGTGGCAAGTGG + Intronic
1136053220 16:27668276-27668298 CAATTCCCACATGTGGTGGGTGG + Intronic
1137245836 16:46703849-46703871 TAATAGCCACACGTGGTTAGTGG - Intergenic
1137380538 16:47994700-47994722 CTGCAGCCTCATGTGGTGAGGGG - Intergenic
1137484032 16:48876828-48876850 CAATAGCCACATGTGGTTAGTGG - Intergenic
1137625421 16:49904874-49904896 CAACAGCCACATGTGGCCAGCGG + Intergenic
1137666067 16:50249786-50249808 CCATTGCCAGGTGTGGGGAGCGG + Intronic
1138107318 16:54295211-54295233 CCATGGCCACATATGGCTAGTGG - Intergenic
1138310518 16:56019696-56019718 CAATAGCTACATGTGGCTAGTGG + Intergenic
1138913614 16:61434494-61434516 CAATAGCCACATGTCGCTAGTGG - Intergenic
1139679555 16:68550705-68550727 GAATAGCCACATGTGGCCAGTGG + Intronic
1140655897 16:77139418-77139440 CCATAGCCAAATTTGGTGGCAGG - Intergenic
1141188441 16:81806179-81806201 CAAAAGCCACATGTGGCTAGTGG + Intronic
1141196327 16:81864306-81864328 AAATGGCCACCTGTGGTGAGGGG - Intronic
1141254295 16:82386422-82386444 CCAGAGCCACCAGTGGGGAGAGG - Intergenic
1141275476 16:82583877-82583899 CCATCACCACATGTGGATAGCGG - Intergenic
1141338191 16:83177139-83177161 TAATAGCCACATGTGGCTAGTGG + Intronic
1141690126 16:85591921-85591943 CTATAGCCACATGTGGCTGGAGG - Intergenic
1141949764 16:87332980-87333002 CCATGGCCACATGTGGCTGGTGG - Intronic
1143085674 17:4414121-4414143 CATTAGCCAGATGTGGTGATGGG - Intergenic
1143570963 17:7758205-7758227 CCATAGCCAAATGTGATGAGTGG + Intronic
1143979485 17:10856015-10856037 TCATAGCCACATGTGGCTAGTGG - Intergenic
1144102293 17:11952498-11952520 AAATAGCCACATGTGGCTAGTGG + Intronic
1144235857 17:13259596-13259618 CAATAGCCACATGTGGCTTGTGG - Intergenic
1144496837 17:15752204-15752226 CAAAAGCCACATGTGGGTAGTGG - Intergenic
1144606401 17:16669590-16669612 CAAAAGCCACATGTGGGTAGTGG - Intergenic
1144904802 17:18632694-18632716 CAAAAGCCACATGTGGGTAGTGG + Intergenic
1145919067 17:28596781-28596803 CAATAGCTACATGTGGCTAGTGG - Intronic
1145977264 17:28991517-28991539 AAATAGCCACATGTGGTCAGTGG + Intronic
1146254469 17:31382661-31382683 CAATGGCCACATGTGGCTAGTGG - Intergenic
1146503934 17:33388367-33388389 CCATTCTCACATGTAGTGAGGGG - Intronic
1146568336 17:33932226-33932248 TCAAAGCCACATGTGGCCAGTGG - Intronic
1146648778 17:34593415-34593437 CCACAGCCACATGTGGTGAGTGG + Intronic
1146782742 17:35689690-35689712 ACATAGCCACATGTGGCTAGTGG - Intronic
1147015360 17:37487848-37487870 AGATAGCCACATGTGGCTAGTGG - Intergenic
1147767818 17:42848865-42848887 TCATAGCCACGTGTGGCTAGTGG + Intronic
1148890793 17:50805809-50805831 CATTAGCCACATGGGGTGGGGGG + Intergenic
1148904284 17:50901848-50901870 CAATCGCCACATGTTGTTAGTGG - Intergenic
1148960258 17:51386475-51386497 CAATAGCCACATGTGTCTAGTGG + Intergenic
1149488536 17:57064753-57064775 CAATAGCTACATGTGGCAAGCGG + Intergenic
1149646837 17:58247324-58247346 AAATAGCCACATGTGGTTAGTGG + Intronic
1149676370 17:58466649-58466671 AAATAGCCACATGTGGCTAGTGG + Intronic
1149732634 17:58961726-58961748 CGATAACCACATGTGGCTAGTGG - Intronic
1149810702 17:59668093-59668115 TAATAGCCACATGTGTTTAGTGG + Intronic
1150426818 17:65083714-65083736 CAGTAGCCACATGTGGCTAGTGG + Intergenic
1150441871 17:65197816-65197838 CAATAGCCAGGTGTGGTGACAGG - Intronic
1150469604 17:65425571-65425593 TAATACCCACATGTTGTGAGAGG + Intergenic
1150546650 17:66165244-66165266 AAATAGCCACATGTGATTAGGGG - Intronic
1151752979 17:76052204-76052226 CAATAACCACATGTGTTGAGCGG + Intronic
1151850217 17:76685564-76685586 CAATAGCCACAGGGGGTGGGGGG - Intronic
1152522045 17:80862418-80862440 CCATGGCCAGACGTGGGGAGGGG - Intronic
1153274430 18:3354022-3354044 CAGTAGCCACATGTGGTTGGTGG + Intergenic
1153404234 18:4718001-4718023 CAAAAGCCACATGTGGTTAGAGG + Intergenic
1154449911 18:14466388-14466410 CAATAGCCACATGTGGCTAGTGG - Intergenic
1154955338 18:21248730-21248752 AAATAGCCACATGTGGCTAGAGG - Intronic
1155297663 18:24399993-24400015 CAATAGCCACATGTGGCTAGTGG - Intergenic
1155455375 18:26006511-26006533 CGATAGCCACATATGGCCAGTGG - Intergenic
1156123371 18:33872751-33872773 CAATAGCCACATATGGATAGTGG + Intronic
1156275998 18:35582884-35582906 TAATAGTCACATGTGGTTAGTGG - Intronic
1156575254 18:38307433-38307455 CAATAGCCACATGAGGCTAGTGG - Intergenic
1157001854 18:43536638-43536660 TAATTGCCACATGTGGTGAGTGG - Intergenic
1157250417 18:46090710-46090732 AAATAGCCACATGTGGTTAGTGG - Intronic
1157278114 18:46326682-46326704 CCGCAGCCATGTGTGGTGAGTGG + Intergenic
1157321839 18:46640723-46640745 TAATAGCCACATATGGTCAGGGG + Intronic
1157573654 18:48730145-48730167 GGCTAGCCACATGTGGTGAAGGG + Intronic
1157845336 18:50999044-50999066 CGATAGCAACATGTGGCAAGTGG - Intronic
1157860259 18:51134816-51134838 CCATGGCCACCTGTGGCTAGTGG + Intergenic
1157899428 18:51500195-51500217 TCATAGCCACATGAGGTTAGTGG + Intergenic
1158268948 18:55691641-55691663 CAATAGCCACATGTGGTCAGTGG - Intergenic
1158422302 18:57306039-57306061 TCATAGCCACATTTGGTTAGAGG + Intergenic
1159016906 18:63108372-63108394 AAATAGCCACATGTGGCTAGTGG - Intergenic
1159109720 18:64042743-64042765 TCATCCCCACATGTGGTGGGAGG - Intergenic
1159460462 18:68716445-68716467 CAATAGCCACATGTGGTTAGTGG - Intronic
1159863430 18:73675787-73675809 CCGTAGCCACACGTGGTAAATGG + Intergenic
1161017660 19:1991226-1991248 CCTTGGCCACTTGTGGTGGGAGG + Intronic
1161429319 19:4222238-4222260 CATTAGCCAGATGTGGTGATGGG + Intronic
1161589006 19:5120391-5120413 CCACAGCCACTTGTGGGCAGAGG + Intronic
1161661168 19:5547177-5547199 CAATAGCTACATGTGGCCAGTGG - Intergenic
1162083280 19:8232647-8232669 CAATAGCCACATGTAGCCAGTGG - Intronic
1162242888 19:9370958-9370980 CAATAGCCACATGAGGCTAGTGG - Intronic
1162963432 19:14142854-14142876 AAATAGCCACATGTGGCTAGTGG - Intergenic
1163425022 19:17236279-17236301 CCATAGAGACATGGGGTGGGGGG + Intronic
1164659759 19:29953187-29953209 TAATAGCCACATGTGGTTAATGG - Intronic
1164847618 19:31448167-31448189 CAGTAGCCACATGTGGCCAGTGG + Intergenic
1165179568 19:33956113-33956135 CAATTCCCACATGTCGTGAGAGG + Intergenic
1165225472 19:34351771-34351793 ACATAGCCACATGTGGTGAATGG - Intronic
1165225563 19:34352435-34352457 CACTAGTCACATGTGGCGAGTGG + Intronic
1165294403 19:34915133-34915155 AAATAGCCACATGTGGTGGCGGG + Intergenic
1165367892 19:35380733-35380755 CCACAGCCCCATGTGGTGACAGG - Intergenic
1165460325 19:35940325-35940347 GCACAGCCAGAGGTGGTGAGCGG - Exonic
1165989580 19:39802032-39802054 CAATAGCCACATGTGGCTAGTGG - Intergenic
1167271209 19:48507511-48507533 CAATAGCCACCTGTGGCCAGTGG - Intronic
1167274280 19:48526976-48526998 CAATAGCCACATGTGGCTAGTGG + Intergenic
1167714583 19:51133763-51133785 CAGTAGCCACATGTGGCTAGTGG - Intronic
1167778618 19:51579818-51579840 CAATAGCTACATGTGGTGAGTGG - Intronic
1168014099 19:53557371-53557393 CCATGGCCACACATGGTGAAAGG + Intronic
925847462 2:8046614-8046636 TAATAGCCACATGTGGCCAGGGG - Intergenic
925896877 2:8479046-8479068 CAATAGACACATGTGGCTAGTGG - Intergenic
925953844 2:8941473-8941495 CACTAGCCACATGTGGCTAGTGG - Intronic
926037797 2:9648755-9648777 CAATAGCCACGTGTGCTTAGTGG - Intergenic
926278869 2:11428447-11428469 AAATAGCCACATGTGGCTAGTGG + Intergenic
926424333 2:12727564-12727586 CCACAGGCACATGTAGGGAGTGG + Intronic
926567028 2:14487472-14487494 CAATAGCCACATGTTGCCAGTGG + Intergenic
926657814 2:15428319-15428341 AAATAGCCACATGTGGCCAGTGG + Intronic
927180321 2:20441778-20441800 TAATAGCCACATGTGGTTACTGG + Intergenic
927837462 2:26411473-26411495 TTATAGCCACATGTGGTTATTGG + Intronic
928000677 2:27520570-27520592 CAATAGCCACATGTGGCTGGTGG - Intronic
929213456 2:39384647-39384669 CAATAGGCACATGTGGTATGGGG - Intronic
929815498 2:45227941-45227963 TCATTCCCACATGTGGTGGGAGG + Intergenic
929823769 2:45294010-45294032 CAATAGCCACATGTGGCTAGTGG - Intergenic
930114156 2:47704599-47704621 CAACAGCCACATGTGGTGAGTGG - Intronic
930133327 2:47875279-47875301 ACATAGTCACATGTGGCAAGTGG + Intronic
930523211 2:52494236-52494258 CAATAGCCACTTGTGGCTAGAGG - Intergenic
930805933 2:55490590-55490612 CCATAGCCATATGTGGCTGGGGG + Intergenic
931174683 2:59841826-59841848 CAACAGCCACATGTGGCTAGGGG + Intergenic
931256788 2:60581320-60581342 CCATGGCCACGTGTGGCTAGTGG + Intergenic
931486743 2:62701423-62701445 CAATAGTCACATGTGGTTAGAGG + Intronic
931488477 2:62718395-62718417 CACTAGCCACATGTGGCTAGCGG + Intronic
931896060 2:66731036-66731058 CCATAGCCACATGGGGCTGGTGG - Intergenic
932133497 2:69208366-69208388 CAATAGCCACATGTGACTAGTGG - Intronic
932140162 2:69269504-69269526 CAATAACCACATGTGGCTAGTGG + Intergenic
932199827 2:69815777-69815799 AAACAGCCACATGTGGTTAGTGG + Intronic
933025080 2:77246533-77246555 CAATAGCCACATGGGTTTAGAGG + Intronic
933049412 2:77584517-77584539 CAATAGCTACATGTGGTTAATGG - Intronic
933227722 2:79769908-79769930 CAGTAGCCACATTTGGTGAATGG - Intronic
933600197 2:84321104-84321126 CAGTAGCCACATGTGGCTAGAGG + Intergenic
933698879 2:85240159-85240181 CCATAGCCACATGTGGCAAGTGG + Intronic
933917064 2:87006232-87006254 CAATAGCCACATGTGGCTAGTGG - Intronic
934005931 2:87763682-87763704 CAATAGCCACATGTGGCTAGTGG + Intronic
934059504 2:88281099-88281121 AAATAGCCACATGTGGCTAGTGG - Intergenic
934059507 2:88281166-88281188 ATCTAGCTACATGTGGTGAGTGG + Intergenic
935140750 2:100350821-100350843 CCATAGCCACGGGTGATGTGGGG + Intergenic
935747087 2:106197988-106198010 TCATAGCAAAATGTGGTGAGTGG + Intergenic
935768887 2:106397782-106397804 CAATAGCCACATGTGGCTAGTGG + Intronic
935911215 2:107898142-107898164 CAATAGCCACATGTGGCTAGTGG - Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
935969325 2:108514979-108515001 CAATAGCCACATGTGGCTAGTGG - Intergenic
936132988 2:109863184-109863206 CAATAGCCACATGTGGCTAGTGG - Intergenic
936211709 2:110508301-110508323 CAATAGCCACATGTGGCTAGTGG + Intergenic
936420848 2:112362878-112362900 CAATAGCCACATGTGGCTAGTGG + Intergenic
936480667 2:112882236-112882258 CAACAGCCACATGTGGCAAGTGG + Intergenic
936508778 2:113129187-113129209 CAATAGCCACATGTGGTTAGTGG + Intronic
936509756 2:113135690-113135712 CAATAGCCTTCTGTGGTGAGTGG + Intergenic
936684712 2:114814581-114814603 CGATAGCTGCATGTGGTTAGTGG + Intronic
936951448 2:117981808-117981830 CAATAGCCACATATGGATAGTGG + Intronic
937969520 2:127538430-127538452 AAATAGCCACATGTGGCTAGTGG + Intronic
938481514 2:131666371-131666393 CAATAGCCACATGTGGCTAGTGG + Intergenic
938732738 2:134158886-134158908 CAATAGCCACATGTGCCTAGTGG - Intronic
939052764 2:137328695-137328717 TAATCCCCACATGTGGTGAGAGG + Intronic
939128575 2:138206234-138206256 CCATTCCCACATGTTGTGGGAGG - Intergenic
939457468 2:142455863-142455885 CAATAGCCACATGTGGCTAGTGG - Intergenic
940256661 2:151738242-151738264 CAATAGCCACATGGGGCTAGTGG - Intergenic
941411682 2:165164987-165165009 CCATAGCCATATGTGGCTAGTGG + Intronic
941614674 2:167705803-167705825 AAATAGCCACATGTGGTTAGTGG - Intergenic
941664837 2:168234385-168234407 AAATAGCCACATATGGTTAGTGG + Intronic
941945356 2:171090934-171090956 CAGTAGCCACATGTGGCCAGTGG + Intronic
942366022 2:175228756-175228778 CAGTAGCCACATGTGGCTAGTGG - Intergenic
942503390 2:176616046-176616068 CAATAGCCACATGTGGCTAGTGG - Intergenic
942533873 2:176942257-176942279 TGATAGCCACATGTGGCTAGTGG + Intergenic
942890825 2:180985291-180985313 CAATAGCCACATGTGGCAAGTGG - Intronic
942928590 2:181461815-181461837 TCAAAGCCACCTGTGGTTAGTGG - Intronic
944416753 2:199486782-199486804 CCAGAGCCACATGTGGCTGGGGG + Intergenic
944458886 2:199923326-199923348 CAATAGCCACAAGTGATTAGTGG - Intronic
944508097 2:200436054-200436076 CAACAGCCACATGTGGCCAGTGG + Intronic
944545978 2:200799333-200799355 ACATAGCCACATGTGGCTGGTGG - Intergenic
944682954 2:202093396-202093418 CAATAGCCACATGTGGCTAATGG - Intronic
944779295 2:203001593-203001615 ACATAGCCACATGAGGTTAATGG - Intronic
944920081 2:204403665-204403687 CAATAGCCACACGTGGCTAGTGG - Intergenic
944962739 2:204893767-204893789 CAACAGCCACATGTGGCTAGTGG + Intronic
944975899 2:205050489-205050511 CAATAGCCACATGTGGCTAGTGG - Intronic
944999516 2:205333228-205333250 CAAAAGCCACATGTGGTTAGTGG - Intronic
945491371 2:210459545-210459567 CAATAGCCACATGTGGCTAGTGG + Intronic
946031647 2:216710042-216710064 CTATAGCCACATGTGCCTAGTGG + Intergenic
946275312 2:218627357-218627379 CAGTAGCCACATGTGGCTAGAGG + Intronic
946534784 2:220615085-220615107 AAAAAGCCACATGTGGTTAGTGG - Intergenic
946629600 2:221652742-221652764 CAATTCCCACGTGTGGTGAGAGG + Intergenic
946883888 2:224203745-224203767 CAATAGCCACATGTGGCTAGAGG + Intergenic
946903275 2:224392979-224393001 CAGTAGCCACATGTGGCGAATGG + Intronic
947029218 2:225773783-225773805 CAATAGCCACATGTGGCTAGTGG + Intergenic
947066282 2:226229151-226229173 CAATAGCCACATGTAGCTAGTGG - Intergenic
947198491 2:227593850-227593872 CAATAGACACATGTGGTAAGTGG + Intergenic
947344535 2:229177187-229177209 CCATTCCCACGTGTTGTGAGAGG - Intronic
947688377 2:232111661-232111683 AAATAGCTACATGTGGTTAGTGG + Intronic
947923253 2:233897721-233897743 CAGTAGCCACATGTGGCTAGAGG + Intergenic
947927335 2:233933277-233933299 CAATAGCCAGATGTGGCTAGTGG - Intronic
948307399 2:236959508-236959530 TAATAGCCACATGTGGCTAGAGG + Intergenic
948372617 2:237499393-237499415 TGATGGCCACATGTGGTTAGTGG + Intronic
1168985285 20:2043089-2043111 CAATAGCCACATGTGGGTAGTGG - Intergenic
1169049496 20:2564074-2564096 AAATAGTCCCATGTGGTGAGTGG + Intronic
1169268930 20:4184345-4184367 CAACAGCCACATGTGGCTAGAGG + Intronic
1169347346 20:4839171-4839193 CCAGAGCCACAGGTGTTGGGAGG + Intergenic
1169358421 20:4927118-4927140 CCATAGCCACACGTGGCTAGTGG - Intronic
1169513908 20:6295918-6295940 AAATAGCCACATGTGGCTAGTGG - Intergenic
1169582259 20:7036817-7036839 CAATAGCCACGTGTGGTTAGTGG + Intergenic
1169610008 20:7368060-7368082 CAATAGCCACATGTGGCCATTGG + Intergenic
1169698110 20:8414798-8414820 AAATAGCCACATGTGGCTAGTGG + Intronic
1169822772 20:9731470-9731492 CAGTAGCCACATGTGGTTAGTGG + Intronic
1169845304 20:9984636-9984658 CAATGGCCACATGTGGCTAGTGG + Intergenic
1169864921 20:10189331-10189353 TAATGGCCACATGTGGTCAGTGG - Intergenic
1169907064 20:10614861-10614883 CCATAGTCAAATGTGGCCAGTGG - Intronic
1169921055 20:10734588-10734610 GAATAGCCACATGTGGCTAGTGG - Intergenic
1169932541 20:10850262-10850284 CAATAGCCACATGTGGCTAGTGG + Intergenic
1170395649 20:15922515-15922537 CCATAGCCATGTGTGGCTAGTGG + Intronic
1170636200 20:18106679-18106701 CAGTAGCCACATGTGGTTAATGG - Intergenic
1170785655 20:19465091-19465113 AGATAGCCACATGTGGCCAGTGG + Intronic
1170851226 20:20006219-20006241 CAATAGCCACATGTGGCTGGTGG + Intergenic
1171009304 20:21499561-21499583 AAATAGCCACATGTGGCCAGTGG - Intergenic
1171009309 20:21499658-21499680 TGATAGCCACATGTGGCTAGTGG + Intergenic
1171113399 20:22503884-22503906 CCAAGGCCACATGTGGCTAGTGG + Intergenic
1171223757 20:23423367-23423389 AAATAGCCACCAGTGGTGAGTGG - Intergenic
1171266724 20:23777182-23777204 CCATGGCCACATGTGGCTGGTGG + Intergenic
1171276269 20:23858826-23858848 CCATGGCCACATGTGGCTGGTGG + Intergenic
1172238022 20:33391425-33391447 AAATAGCCACATGTGGCTAGTGG + Intronic
1172280815 20:33706730-33706752 CAGTAGCCACATGTGGCTAGTGG - Exonic
1172595119 20:36145735-36145757 TCATAGCCACATGTGGTTAGTGG - Intronic
1172668829 20:36619777-36619799 AAATAGCCACGTGTGGTGACAGG - Intronic
1172687360 20:36766263-36766285 CCATAGCTACCTTTGGGGAGAGG + Intronic
1172859564 20:38036885-38036907 CAATAGCCACACGTGGCTAGTGG + Intronic
1172986312 20:38993725-38993747 CTATAGCCACAGGTGGCTAGTGG + Intronic
1173007241 20:39149843-39149865 CAATAGCCACATGTGGCTGGTGG + Intergenic
1173200389 20:40950430-40950452 AAATAGCCACATGTGGTTGGTGG - Intergenic
1173342569 20:42165627-42165649 CAGTAGCCACATGTGATTAGTGG - Intronic
1173406440 20:42770326-42770348 CCACAGCCACATGTAGTTAGTGG + Intronic
1173495031 20:43512593-43512615 CAATAGCCACATGTGGCTAGTGG + Intronic
1173653972 20:44686199-44686221 CAGCAGCCACATGTGGTGGGTGG - Intergenic
1173730321 20:45323971-45323993 CAACAGCCACATGTGGCTAGTGG - Intergenic
1173793960 20:45845745-45845767 CCATAGTCACATGTGGCTAGTGG - Intronic
1173980586 20:47220903-47220925 CAGTAGCCACATGTGGCTAGTGG - Intronic
1174078607 20:47955426-47955448 CCATAGTCACATGTGGCTAGCGG + Intergenic
1174509854 20:51042849-51042871 ACATTGCCCCTTGTGGTGAGTGG + Intergenic
1174580055 20:51564910-51564932 TAATAGCCACATGTGGCTAGTGG - Intergenic
1174586626 20:51613638-51613660 CCACAGGCACATGTGCAGAGGGG + Intronic
1174662359 20:52224557-52224579 CAATGGCCACATGTGGCTAGGGG - Intergenic
1174725614 20:52858680-52858702 CGATGGCCACATATGGTGAGTGG - Intergenic
1174729944 20:52906255-52906277 CAATAGCCACAAGTGGTGCAGGG + Intergenic
1175714808 20:61248167-61248189 CCTGGGCCACATGTGGAGAGGGG + Intergenic
1176446263 21:6823969-6823991 CAATAGCCACATGTGGCTAGTGG + Intergenic
1176824432 21:13688999-13689021 CAATAGCCACATGTGGCTAGTGG + Intergenic
1177021863 21:15871002-15871024 CAGTAGCCTCATGTGGTTAGTGG + Intronic
1177222465 21:18211734-18211756 CAATAGTCACATATGGTTAGTGG + Intronic
1177554643 21:22673071-22673093 ACATTCCCACATGTTGTGAGAGG + Intergenic
1177862070 21:26465735-26465757 GCATAGCCTCATGTGGCTAGGGG - Intergenic
1178355371 21:31906847-31906869 CAACAGCTACATGTGGTGAGAGG - Intronic
1178712248 21:34928176-34928198 CAGTAGCCACATGTGGCTAGTGG + Intronic
1178788580 21:35676931-35676953 CTACAGCCACTTGCGGTGAGTGG - Intronic
1179132524 21:38651402-38651424 CCATAGTCACATGTGGCTAGTGG - Intronic
1179155544 21:38847892-38847914 GCATAGCCGCATGTGATGACAGG + Intergenic
1179722907 21:43325497-43325519 CCAGGGCCACATGTGGTGCAAGG - Intergenic
1179928980 21:44554651-44554673 CAAGAGCCACGTGTGGTTAGCGG - Intronic
1180482738 22:15769966-15769988 CAATAGCCACATGTGGCTAGTGG + Intergenic
1181530529 22:23514559-23514581 CCAGTGCCCCATGTGGTGGGAGG - Intergenic
1181983930 22:26786034-26786056 ACATAGCCCCATGTTGGGAGCGG + Intergenic
1182113503 22:27741574-27741596 CAAGAGCCACATGTGGCTAGTGG + Intergenic
1182171908 22:28239282-28239304 CAATAGCCACATGTGGCTATTGG - Intronic
1182408708 22:30162373-30162395 CAATAGCCACATGTGGCTAGTGG - Intronic
1182409034 22:30166376-30166398 CAATAGCCACATGTGGTAAGTGG - Intronic
1183370615 22:37429760-37429782 CAATAGCCACATGCAGTTAGTGG - Intergenic
1183729062 22:39607006-39607028 CCATTGCCACCTGTGGGGAGGGG + Intronic
1183777609 22:39977198-39977220 CAATAGCCACATGTGGCTAGTGG - Intergenic
1183789258 22:40051975-40051997 CAGTAGCCACATGTGGCTAGTGG + Intronic
1183993250 22:41613073-41613095 AAATAGCCACATGTGGTCAGTGG - Intronic
1185238551 22:49728369-49728391 CCACAGCCACAAGTCGTGAGGGG + Intergenic
949207862 3:1461758-1461780 CAATAGCCACAGGTGGCCAGAGG + Intergenic
949249793 3:1970187-1970209 CAATAGCCACATCTGGGGAGGGG - Intergenic
949811386 3:8010726-8010748 CAGTAGCCACATGTGGCCAGTGG + Intergenic
949938370 3:9135065-9135087 AAATAGCCACATGTGGCTAGTGG - Intronic
950404343 3:12795416-12795438 CAATAGCCACATGTGGCTAGTGG + Intergenic
950581672 3:13866352-13866374 CCATTCCCACAGGTGGCGAGAGG - Intronic
950788065 3:15452008-15452030 CAATAGCCACATCTGGCCAGTGG - Intronic
950805933 3:15603120-15603142 TAATCCCCACATGTGGTGAGAGG - Intronic
950888792 3:16384723-16384745 AAATAGCCACATGTGGCTAGTGG - Intronic
950895633 3:16448022-16448044 CGATAGCCACATGTGGCTGGTGG - Intronic
950902299 3:16508918-16508940 CCAGAGCCACGTGTGGTTAGTGG - Intronic
950914556 3:16631374-16631396 CAATAGCCACGTGTGGCCAGTGG + Intronic
951051743 3:18101588-18101610 CCATAGCCATATGTTGCTAGTGG + Intronic
951126704 3:18993338-18993360 CAATAGCCACATGTGGCTAATGG - Intergenic
951130825 3:19042106-19042128 CAATAGGCACATGTGGCTAGTGG - Intergenic
951188573 3:19742787-19742809 CAATAGCCACATGTGGCCAGCGG - Intergenic
951221289 3:20071246-20071268 CAATAGCCACATGTGGCCAGAGG + Intronic
951482902 3:23180464-23180486 CAAAAGCCACATGTGGCTAGTGG - Intergenic
951648012 3:24915461-24915483 CAATAGCCACATGTGGCTAATGG + Intergenic
951691909 3:25405623-25405645 AAATTGCCACATGTGGTTAGTGG - Intronic
951699693 3:25483047-25483069 CAATAGCTACATGTGGCTAGTGG + Intronic
951863813 3:27284454-27284476 CAATAGCCACATGTGGCTAGTGG + Intronic
951981380 3:28570786-28570808 CAATAGCCACATGTGGCTGGTGG + Intergenic
952129200 3:30339692-30339714 CAGTAGCCACATGTGATAAGTGG - Intergenic
952205129 3:31173544-31173566 CAACAGCCACATGTGGTGAATGG - Intergenic
952234562 3:31465423-31465445 CATTAGCCACATGTGGCTAGTGG + Intergenic
952280114 3:31914814-31914836 CAATAGCCACATGTGGCTACTGG + Intronic
952521568 3:34163952-34163974 AAATAGCCACATGTGGCTAGTGG - Intergenic
952739558 3:36722568-36722590 CAATTCCCACATGTTGTGAGGGG + Intronic
952761229 3:36916199-36916221 ACATAGCCACATGTGGCTAGTGG + Intronic
952887261 3:38019374-38019396 CAATAGCCACAAGTGGCTAGTGG + Intronic
952927351 3:38329765-38329787 CAATAGCCACATGTGGCTAGTGG - Intergenic
953034437 3:39199994-39200016 CAGTAGCCACATGTGGTGAGTGG + Intergenic
953149019 3:40307328-40307350 CAATGGCCACATGTGGCTAGTGG + Intergenic
953168298 3:40484741-40484763 AAATAGCCACATGTGGCTAGTGG + Intronic
953348666 3:42197888-42197910 GCACAGCCACATGTGGCCAGTGG - Intronic
953472059 3:43176068-43176090 CTGTAGCCACATGTGGCTAGTGG - Intergenic
953774393 3:45803167-45803189 CAATAGCCACATGTGGTTAGTGG + Intergenic
953959927 3:47258944-47258966 CCATAGCTACATGTGGCCAGTGG + Intronic
954593824 3:51807409-51807431 CAATAGCCACATGTGCCTAGGGG - Intergenic
954746512 3:52790577-52790599 CCCAAGCAACATGTGGGGAGGGG + Intronic
954761778 3:52879896-52879918 CCCTAGCTACATGAAGTGAGGGG + Intronic
954788581 3:53113788-53113810 CTATAGCCACATGTGGCTGGTGG + Intronic
954967411 3:54623735-54623757 CATTAGCCACATGTGGCTAGTGG - Intronic
955025883 3:55166947-55166969 AAATAGCCACGTGTGGTAAGGGG + Intergenic
955137661 3:56235798-56235820 TAATAGCCACATGTGGCTAGCGG + Intronic
955345499 3:58158264-58158286 CAATAGTCACATATGGTTAGTGG - Intronic
955710800 3:61777337-61777359 AAATAGCCACATGTGGCTAGTGG + Intronic
955717593 3:61846969-61846991 GAATAGCCACATGTGGCTAGTGG - Intronic
955809114 3:62767994-62768016 CAACAGCCACATGTGGCTAGTGG + Intronic
955858165 3:63296917-63296939 GTATAGCCATATGTAGTGAGTGG - Intronic
955877498 3:63508107-63508129 CAATAGCCACATGTGGCTAGTGG + Intronic
956068487 3:65422157-65422179 CCATAGCCACATGTGGCGAGTGG - Intronic
956075327 3:65498869-65498891 GAATAGCCACATGTGGCTAGTGG + Intronic
956215205 3:66841749-66841771 CCTTAGCCACATGTGGTTAGTGG + Intergenic
956352766 3:68356049-68356071 CAATAGCCACAAGTGGCTAGCGG + Intronic
956620769 3:71219340-71219362 CAGTAGCCACATGTGGCCAGTGG - Intronic
956687830 3:71847615-71847637 CAATAGCCCCATGTGGCTAGTGG + Intergenic
956771524 3:72530199-72530221 CCATAGCCACATGTAGCTAGTGG + Intergenic
956801883 3:72766891-72766913 CGACAGCCACATGGGGTTAGTGG - Intronic
956897371 3:73676789-73676811 CCATAGACATATGTAATGAGTGG - Intergenic
957303327 3:78421869-78421891 CAATAGCCACATGTGCCTAGTGG + Intergenic
957606797 3:82410146-82410168 CAATAGCCACATGTGGTTCGTGG - Intergenic
958023369 3:88022530-88022552 TCATACCCACATGTTGTGGGAGG - Intergenic
958434953 3:94085114-94085136 TCATAGCCACATGTGAGAAGAGG + Intronic
958860100 3:99436031-99436053 GAATTGCCACGTGTGGTGAGAGG + Intergenic
958949828 3:100404401-100404423 CAATAGCCACATGTGGCTAGTGG - Intronic
958962638 3:100524544-100524566 CAATAGCCACATGTGGCTCGTGG - Intronic
959330292 3:104996550-104996572 CCATGAACAGATGTGGTGAGGGG + Intergenic
960432537 3:117587262-117587284 CAATAGCCACATGTGGTGGGTGG + Intergenic
960490100 3:118307102-118307124 CAATAGCCACATACGGTTAGTGG - Intergenic
960789370 3:121411206-121411228 CAATAGCTACATGTGGTTACTGG + Intronic
961073082 3:123954880-123954902 GAATAGCCACATGTGGCCAGTGG + Intronic
961084236 3:124052870-124052892 CCATAGTGACAAGTGGGGAGAGG + Intergenic
961199358 3:125032126-125032148 CCATAGCCACACGTGGCTGGTGG + Intronic
961731195 3:128966227-128966249 CCATAGCCACATGAGGGTACTGG - Intronic
961927684 3:130498885-130498907 CAAGAGCCACATGTGGTTAGTGG + Intergenic
962110727 3:132443910-132443932 AAATAGCCACATGTAGTTAGCGG - Intronic
962211177 3:133479900-133479922 CAATAGCCACATGTGGCCAGTGG + Intergenic
962500613 3:135987811-135987833 CAATAGCCACATGTAGGAAGTGG + Intronic
962599581 3:136981340-136981362 CAATAGCCACATGTGGCCAGTGG + Intronic
962692638 3:137915576-137915598 CAATAGCCACATGTGGCTAGTGG + Intergenic
962773203 3:138632393-138632415 CAATAGCCACATGTGGCCAGTGG + Intronic
962925113 3:139985943-139985965 AAATAGCCACATGTGGCTAGTGG + Intronic
963228244 3:142884889-142884911 CAATAGCCACATGTGGATAGTGG - Intronic
963239063 3:142984755-142984777 CAATAGCCACATGTGGCCAGTGG - Intronic
963547251 3:146675570-146675592 CAATAGCCACATGTGGCTAAGGG + Intergenic
963707807 3:148710058-148710080 CAGTAGACACATGTGGTTAGTGG + Intronic
963938731 3:151080334-151080356 CAATAGTCACATGTGGCTAGTGG - Intergenic
963985209 3:151585097-151585119 CTACAGCCACATGTGGCTAGCGG - Intergenic
964461495 3:156935725-156935747 CAATAGCCCCATGTGGTTGGTGG - Intronic
964683984 3:159374836-159374858 CTATAGCCACATGTGGCTAATGG - Intronic
964801311 3:160562156-160562178 TAATAGCCACATGTGGTTAGTGG - Intronic
964874577 3:161351933-161351955 TAATAGCCACATGTGGCTAGTGG + Intronic
965481235 3:169222070-169222092 CAATAGCCACATGTGGCTAGAGG + Intronic
965611117 3:170544970-170544992 CAATAGCCACATGTAGCTAGTGG - Intronic
965833014 3:172817116-172817138 TCATAGCCACAAGTGGCTAGTGG + Intronic
966014522 3:175125096-175125118 CAGTAGCCACATGTGGCTAGTGG - Intronic
966104281 3:176317149-176317171 AAATAGCCACATGTGATAAGTGG + Intergenic
966658578 3:182388087-182388109 CAATAGCTACATGTGGTTAACGG + Intergenic
966951789 3:184826432-184826454 CAATAGCCACGTGTGGCTAGTGG + Intronic
967008946 3:185413375-185413397 CACTAGCCACATGTGGCTAGTGG - Intronic
967333915 3:188321260-188321282 CAACAGCCACATGTGGTTAGTGG - Intronic
967861128 3:194152729-194152751 TCATAGGCCCATGTGATGAGGGG - Intergenic
968859235 4:3153157-3153179 CCTTGCCCTCATGTGGTGAGGGG + Intronic
969147984 4:5141063-5141085 AAATATCCACATGTGGTTAGTGG - Intronic
969232385 4:5840659-5840681 AGATAGCCACGTGTGGTTAGTGG + Intronic
969313704 4:6369141-6369163 AAATAGCCACATGTGGCCAGTGG - Intronic
971070295 4:23083197-23083219 CAATAGCCACATGTGATTAATGG - Intergenic
971096368 4:23409201-23409223 CAATACCCACATGTTGTGGGAGG - Intergenic
971477523 4:27086323-27086345 AAATAGCCCCATGTGGTTAGAGG - Intergenic
971895441 4:32587255-32587277 CAATAGACACATGTGGCTAGTGG + Intergenic
972030702 4:34454091-34454113 TAATTCCCACATGTGGTGAGAGG - Intergenic
972245073 4:37237595-37237617 TAATTCCCACATGTGGTGAGAGG - Intergenic
972274302 4:37542607-37542629 CAAAAGCCACATGTGGCTAGTGG - Intronic
972365502 4:38370846-38370868 CGATAACCACATGTGGCTAGTGG + Intergenic
972410396 4:38787760-38787782 CCATAGCCACATACGGCTAGTGG + Intergenic
972613411 4:40675859-40675881 CCATAGTCACATCTAGTAAGTGG + Intergenic
972830904 4:42812517-42812539 CAATAGCCACATGTGGCTAGGGG - Intergenic
973644345 4:52935064-52935086 AAATAGCCACATGTGGCTAGTGG + Intronic
973709904 4:53619076-53619098 CAAGAGCCACATGTGGCTAGTGG + Intronic
974048880 4:56921310-56921332 TAATAGCCACATGTGGCTAGTGG - Intronic
974358067 4:60837705-60837727 CAACAGCCACATGTGGCTAGTGG + Intergenic
974531148 4:63109300-63109322 CAATACCCACATGTTGTGGGAGG + Intergenic
975609594 4:76190861-76190883 CAATAGCCACATGTGTCTAGTGG - Intronic
975889894 4:79015149-79015171 CAATAGTCACATGTGGCTAGTGG - Intergenic
976396271 4:84559113-84559135 CAGTAGCCACATATGGTTAGTGG + Intergenic
976835890 4:89373045-89373067 CAATAGCTGCATGTGGTTAGTGG - Intergenic
977230922 4:94451045-94451067 CGATAGCCACATGTGGCCAGTGG + Intergenic
977341182 4:95760722-95760744 GAATATCCACATGTTGTGAGAGG + Intergenic
977658645 4:99555744-99555766 CAATAGCCACATGTGGATAGTGG + Intronic
977761670 4:100745429-100745451 CAATAGCCACATGCAGTTAGTGG + Intronic
978167234 4:105623900-105623922 CCATGGCCAGATGTACTGAGTGG + Intronic
978279262 4:106990256-106990278 CAATAGCCACATGTAGCCAGTGG + Intronic
978606769 4:110489164-110489186 CCATAGACTCCTTTGGTGAGTGG + Intronic
978683149 4:111407709-111407731 CCATAGCCATATGTGACAAGTGG + Intergenic
978718946 4:111882395-111882417 TCATAGCCACATGTGGCCAGTGG - Intergenic
979607204 4:122651168-122651190 CAATAGCCACAGGTGGTAATTGG - Intergenic
979633476 4:122929822-122929844 TGATAGCTACATGTGCTGAGTGG + Intronic
979658143 4:123221064-123221086 CAATAGCCACATGTGGCCAGTGG - Intronic
980161223 4:129165270-129165292 CCAAAGCCACATGTGGCCAGTGG - Intergenic
980324599 4:131324853-131324875 CAATTCCCACATGTTGTGAGAGG + Intergenic
980436405 4:132780188-132780210 CAACAGCCACATGTGGCTAGTGG + Intergenic
980802778 4:137773985-137774007 CAATAGCCACATGTAGTCATAGG + Intergenic
980944676 4:139307650-139307672 AAATAGTCACATGTGGTGAATGG + Intronic
981006018 4:139876028-139876050 CAACAGCCACATGTGGCTAGTGG - Intronic
981082699 4:140650930-140650952 TCATAGCCACATGTAGCAAGTGG + Intronic
981569941 4:146141374-146141396 CCATAACCATATGTGGCTAGTGG - Intergenic
981949476 4:150388896-150388918 CAATAGCCACATGTGGCTAGTGG + Intronic
982122383 4:152155719-152155741 CAGTAACCACATGTGGTCAGCGG + Intergenic
982124275 4:152170978-152171000 TAGTAGTCACATGTGGTGAGTGG + Intergenic
982375969 4:154690977-154690999 CCATAGCCACATGTGGTGAGTGG - Intronic
983295317 4:165859631-165859653 CAGTAGCCACATGTGATTAGTGG + Intergenic
983528737 4:168787489-168787511 AAATAGCCACATGTGGTTAGTGG - Intronic
983882833 4:172952312-172952334 CCATAGCCTCAGGTGGTGGGAGG + Intronic
983943178 4:173557855-173557877 CAATAGCCACATGTGACTAGGGG - Intergenic
984156012 4:176196880-176196902 AAATAGCCACATGTGGCTAGTGG - Intergenic
984365096 4:178788943-178788965 CAATAGCCACATGTGGATACCGG - Intergenic
984791671 4:183620434-183620456 ACATAACCACATGTGGCTAGTGG - Intergenic
984791679 4:183620530-183620552 CAATAGCCACATGTGGCTAGTGG + Intergenic
984800483 4:183711247-183711269 CAATAGTCACATGTGGCTAGTGG - Intronic
985657926 5:1141710-1141732 CGATAGCCACATGTGGCCGGTGG + Intergenic
986155239 5:5167801-5167823 CAATTGCCACATGTGGCGGGTGG - Intronic
987067071 5:14300319-14300341 CAATAGCCACACATGGTGACAGG - Intronic
987160288 5:15134498-15134520 AAATAGCCATATGTAGTGAGTGG + Intergenic
987364325 5:17135255-17135277 CGATAGCCACAGGTGGCTAGTGG - Intronic
987710998 5:21500365-21500387 CAATAGCCACATGTAGCTAGTGG - Intergenic
988071515 5:26295138-26295160 CCATAGGCATATATGTTGAGAGG - Intergenic
988341019 5:29972070-29972092 AAATAGCCACATGTGGCTAGTGG + Intergenic
988427064 5:31076086-31076108 CAGTAGCCACATGTGGTTAGTGG + Intergenic
988578813 5:32451338-32451360 CAATAGCCACATGTGGCCAGTGG - Intergenic
988749144 5:34177250-34177272 CAATAGCCACATGTAGCTAGTGG + Intergenic
988800866 5:34695476-34695498 CAAGAGCCACATGTGGGCAGTGG - Intronic
988827893 5:34958049-34958071 CCACAGCCACAGCTGGTTAGGGG + Exonic
988855684 5:35226084-35226106 CAATAGGCACATGTGGCTAGTGG + Intronic
988863743 5:35311906-35311928 CAAAAGCCACAGGTGGTTAGTGG + Intergenic
988916278 5:35896593-35896615 AAATAGCCACATGTGGCTAGTGG - Intergenic
989038902 5:37206017-37206039 CAATAGTTACTTGTGGTGAGTGG + Intronic
989638304 5:43558320-43558342 CAAGAGCCACATGTGGCTAGTGG + Intergenic
990439142 5:55826841-55826863 CAATAGCCACATGTGGCTAGTGG + Intergenic
990623262 5:57583358-57583380 CAGTAGCCACATGTGTTTAGTGG + Intergenic
990686864 5:58313770-58313792 CAATAGCCACATGTGGATAATGG - Intergenic
990922761 5:60985834-60985856 CAATTCCCACATGTGGTGGGAGG - Intronic
990963508 5:61419513-61419535 AAATAGCCACATGTGGCTAGTGG - Intronic
990968334 5:61474647-61474669 CAGTAGCCACATGTGGCTAGTGG + Intronic
991354163 5:65750232-65750254 CAATAGCCACTTGTAGTAAGTGG - Intronic
991449303 5:66734753-66734775 AAATAGCCACATGTGGTTGGTGG + Intronic
991527755 5:67580946-67580968 GTATAGACACATGTGGTTAGTGG - Intergenic
991656801 5:68912387-68912409 CAGTAGCCACATGTGGTTATTGG - Intergenic
991761337 5:69919426-69919448 CAATAGCCACATGTAGCTAGTGG - Intergenic
991785992 5:70198674-70198696 CAATAGCCACATGTAGCTAGTGG + Intergenic
991840565 5:70794474-70794496 CAATAGCCACATGTAGCTAGTGG - Intergenic
991878436 5:71199065-71199087 CAATAGCCACATGTAGCTAGTGG + Intergenic
991986025 5:72287742-72287764 CCATACCAACATGTGTTTAGTGG - Intronic
992126488 5:73647649-73647671 CAGTAGCCACATGTGGCAAGTGG + Intronic
992733478 5:79695516-79695538 TCATAGCCACATGTAGCTAGTGG + Intronic
993171418 5:84424312-84424334 CAAAAGCCACATGTGGTTAATGG + Intergenic
993361156 5:86978079-86978101 CAATAGCCACATGTGTCCAGTGG + Intergenic
993520228 5:88890542-88890564 CAATAGCCACATGTGGCTAGTGG + Intronic
993522215 5:88916662-88916684 CAATAGCCACATGTGGTCAGGGG + Intergenic
993669990 5:90748536-90748558 CAATAGCCACATGTGGCCAGTGG + Intronic
994366704 5:98925898-98925920 AAATAGCCACATGTGGCTAGTGG + Intronic
994831525 5:104788746-104788768 CCACTGCCACATGTTGTGGGAGG + Intergenic
994894743 5:105688409-105688431 CCATAGCCACTAGGGGTGGGGGG - Intergenic
995346496 5:111125911-111125933 CAATAGCTACATGTGGCAAGTGG - Intronic
995377139 5:111487711-111487733 CAATAGTCACATGTGGCTAGTGG + Exonic
995723325 5:115160474-115160496 TAATAGCCACATGTGGCTAGTGG + Intronic
996471430 5:123865705-123865727 CGATAGCCACATGTGGCGAGTGG + Intergenic
997084469 5:130781824-130781846 CAATAGCAACATGTGTTCAGTGG + Intergenic
997243410 5:132325351-132325373 CAATAGCTACATGTGGTTAGTGG + Intronic
997263550 5:132481595-132481617 AAATAGTCACATGTGGTCAGTGG - Exonic
997330909 5:133060957-133060979 AAATAGCCACATGTGGCTAGTGG + Intronic
997338992 5:133127692-133127714 CAATAGCCACATGTGGCTAGTGG - Intergenic
997467137 5:134095830-134095852 CAATGGCCACATGTGGCTAGTGG + Intergenic
997705526 5:135948429-135948451 GCATAACCACATGTGGCTAGTGG - Intronic
998027676 5:138833340-138833362 CAATAGCCACATATGGTGAGTGG - Intronic
998186114 5:139981346-139981368 CCATGGCCATGTGGGGTGAGTGG - Intronic
998268988 5:140690153-140690175 ACATAACCACATGTGGTGGCCGG + Intronic
998707608 5:144781577-144781599 CAATAACCACATGTGGCTAGTGG + Intergenic
998770475 5:145538487-145538509 CAATGGCCACATGTGGCAAGTGG + Intronic
999048401 5:148494765-148494787 CATTAGCCACATGTGGTGAGTGG - Intronic
999451339 5:151680556-151680578 AAATAGCCACATGTGGCTAGTGG + Intronic
999459497 5:151745771-151745793 CCAGAGCCATGTGTGGTGATAGG + Intronic
999642675 5:153687630-153687652 CAGTAGCCACATGTGGCTAGTGG + Intronic
1000224594 5:159248201-159248223 CAATAGCCACATGTGGCTAGTGG - Intergenic
1000408235 5:160911447-160911469 CCCTGGCCACATTTGGTGAACGG - Intergenic
1000649202 5:163795214-163795236 CCATAGCCACACATGGCCAGTGG - Intergenic
1001267677 5:170286601-170286623 AAGTAGCCACATGTGGTTAGAGG + Intronic
1001700424 5:173702686-173702708 CGGTAGCCACATCTGGAGAGTGG + Intergenic
1001703062 5:173721339-173721361 ACACAGCCTGATGTGGTGAGTGG - Intergenic
1001704480 5:173731859-173731881 CCATGGCCACATGTGGCCAGTGG - Intergenic
1001781631 5:174373920-174373942 GCATAGTAACATGTGATGAGAGG + Intergenic
1002586159 5:180249900-180249922 CCACAGCCTCCTGTGGTTAGTGG + Intronic
1003370173 6:5517246-5517268 CACTAGCCACATGTGGCCAGTGG - Intronic
1003484835 6:6566662-6566684 CAATAGCCACATGTGGCTAGTGG - Intergenic
1003689156 6:8335850-8335872 CAATAGCCACATGTGGCTCGTGG + Intergenic
1003715180 6:8638560-8638582 CAATAGCCACATGTGGCAAGTGG + Intergenic
1003902691 6:10669465-10669487 CAATAGCCATATGTGGCTAGTGG + Intergenic
1003957794 6:11180414-11180436 AAATAGCCACATGTGTTTAGTGG - Intergenic
1004134643 6:12954921-12954943 CAGTAGCCACATGTGGTTAGTGG - Intronic
1004378671 6:15113694-15113716 CAGTAGCCACATGTGATCAGTGG - Intergenic
1004738249 6:18430134-18430156 AAATAGCCACATGTGGCTAGTGG - Intronic
1004784891 6:18957237-18957259 CCATAGCCACATGTGGGTAGTGG + Intergenic
1004837972 6:19549462-19549484 CAATAGCTACATGTGGCTAGTGG - Intergenic
1005099741 6:22158129-22158151 CCATAGCCATATGAGGCTAGTGG - Intergenic
1005100057 6:22161983-22162005 AAATAGCCACATGTGGCTAGTGG + Intergenic
1005456234 6:26022168-26022190 CCCTACCCATATGTAGTGAGTGG - Intergenic
1005479074 6:26238263-26238285 CAGTAGCCACATATGGTTAGTGG - Intergenic
1005887714 6:30109493-30109515 CAGTAGCCACATGTGGTTGGTGG - Intronic
1006270888 6:32966612-32966634 CAATAGCCACATGTGACTAGTGG - Intronic
1006292609 6:33151467-33151489 CAATAGCCACATGTGAATAGTGG + Intergenic
1006596655 6:35198351-35198373 CAATAGCCACATGTGGTATGTGG + Intergenic
1006600879 6:35224980-35225002 CAATAGCCACATGTGGCTAGTGG - Intronic
1006849027 6:37083989-37084011 CAATAGCCACATGTTGATAGTGG - Intergenic
1007029230 6:38612975-38612997 CGGTAGCCACATGTGGCAAGTGG - Intronic
1007217105 6:40248874-40248896 CAATAGCCATATGTGGCTAGTGG - Intergenic
1008873544 6:56301672-56301694 AAATAGCCACATGTGGTTAGTGG - Intronic
1009017446 6:57921218-57921240 CAATAGCCACATGTAGCTAGTGG + Intergenic
1009034837 6:58104463-58104485 CAGTAGCCACATGTGGTTTGTGG - Intergenic
1009768426 6:68112653-68112675 CAATAACCACATGTGCTTAGTGG + Intergenic
1010188693 6:73171632-73171654 CGATAGCCACAGGTGGCCAGTGG + Intronic
1010205200 6:73316192-73316214 CAACAGCCACATGTGGCTAGTGG - Intergenic
1010252186 6:73719176-73719198 CAATAGCCACATGTATTTAGAGG + Intronic
1010949704 6:82020925-82020947 CAATAGCCACATGTAGCTAGTGG - Intergenic
1011403226 6:86987538-86987560 CAATAGGCACATGTGATTAGTGG - Intronic
1011631693 6:89332543-89332565 CCATAGCCACATGTGGCTAATGG - Intronic
1011772561 6:90691192-90691214 AAATAGCCACATGTGGTTAATGG - Intergenic
1011820380 6:91246224-91246246 CAATAGCCACATGTGGCTAATGG + Intergenic
1012164454 6:95930810-95930832 CAATAGCCACATGAGTTAAGTGG + Intergenic
1012426339 6:99118799-99118821 GAATAGCCACATGTGGTGGGTGG - Intergenic
1012508870 6:99979413-99979435 CAGTAGCCACATGTGGCTAGTGG - Intronic
1012724853 6:102798097-102798119 CCATAGCAAAATGTGAGGAGTGG - Intergenic
1013381285 6:109573935-109573957 CAATAGCCACATGTAGCTAGTGG - Intronic
1013739139 6:113263109-113263131 CAATAGCCACCTGTGGCTAGTGG + Intergenic
1013805540 6:113992291-113992313 CAATAGCCACATGTTGCCAGTGG + Intronic
1013837731 6:114352302-114352324 TCATAGCTACATGGGGTTAGGGG - Intergenic
1013837985 6:114355494-114355516 CAACAGCCACATGTGGTTACTGG + Intergenic
1013986675 6:116202043-116202065 CGGTAGCCACATGTGGTTAATGG - Intronic
1014000145 6:116356339-116356361 CAATAGCCACATGTGCCTAGTGG - Intronic
1015131877 6:129820270-129820292 CAATAGCCACATGTAGCTAGTGG + Intergenic
1015369438 6:132434567-132434589 CCATAACCATATGTCATGAGAGG + Intergenic
1015451737 6:133377391-133377413 AAATAGCCACGTGTGGTTAGTGG + Intronic
1015464023 6:133527666-133527688 CAATAGCCACATGTGGCTGGTGG + Intronic
1015564700 6:134556886-134556908 CAGTAGCCACATGTGGTTAGTGG - Intergenic
1015648915 6:135431585-135431607 CCATATACACATGTACTGAGAGG - Intronic
1015820780 6:137258356-137258378 GAATAGCCACATGTGGTCAGTGG - Intergenic
1016016476 6:139191480-139191502 CCGTAGTCACATGTGGCTAGTGG + Intergenic
1016326789 6:142912186-142912208 CCAAAGCCACTTGTGTTTAGTGG + Intronic
1016378314 6:143447256-143447278 AAATAGACACATGTGGTTAGTGG + Intronic
1016518241 6:144921299-144921321 AAATAGCCACATGTGGCTAGTGG + Intergenic
1017033404 6:150244598-150244620 CCATAGCCACAGATGGCTAGTGG - Intronic
1017033409 6:150244693-150244715 AAATAGCCACATATGGTTAGTGG + Intronic
1017216202 6:151910169-151910191 CAATAGCCACCTGTGGCTAGTGG - Intronic
1017245588 6:152221084-152221106 ACATATCCACATTTGGTGAGAGG - Intronic
1018376078 6:163214255-163214277 AAATAGCCACATGTGGCTAGTGG + Intronic
1018809854 6:167290684-167290706 CAATAGTCACATGTGGCGAGTGG + Intronic
1018837728 6:167497862-167497884 CCATAGTCCCATGTCGTGGGGGG + Intergenic
1019789366 7:3000815-3000837 CCACGGCCACAGCTGGTGAGTGG + Intronic
1019971499 7:4544470-4544492 CGGTAGCCACATGTGGCTAGTGG + Intergenic
1020334883 7:7055633-7055655 AAATAGCCACATGTGGCTAGTGG + Intergenic
1020475557 7:8589956-8589978 CAATAACCACATGGGGTTAGGGG + Intronic
1021040671 7:15858093-15858115 CTATATCCACATGAAGTGAGGGG - Intergenic
1021364264 7:19756936-19756958 CAATAGCCACATGTGGCTATTGG + Intronic
1021883979 7:25120545-25120567 TAACAGCCACATGTGGTTAGTGG + Exonic
1021972792 7:25981805-25981827 CAATAGCCACAAGTGGCCAGTGG - Intergenic
1022525020 7:31031378-31031400 CAAAAGCCACATGTGGCCAGTGG - Intergenic
1022625166 7:32028229-32028251 CAAGAGCCACATGTGGCTAGTGG + Intronic
1022711524 7:32855268-32855290 AAATAGCCACATGTGGCTAGTGG + Intergenic
1022849606 7:34246627-34246649 CAGTAGCCACATGTGGCCAGTGG + Intergenic
1022913133 7:34919691-34919713 AAATAGCCACATGTGGCTAGTGG - Intergenic
1023256954 7:38322114-38322136 CAATAGCCACAGGTGGCTAGTGG + Intergenic
1023374678 7:39544150-39544172 TGATAGCCACACGTGGTGAGTGG - Intergenic
1023426394 7:40041571-40041593 CATTAGCCACATGTGGCTAGTGG + Intronic
1023451322 7:40288880-40288902 CAATAGCCACATGTGGGCAGTGG + Intronic
1023465185 7:40446868-40446890 CAATAGCCACGTGTGGCTAGTGG - Intronic
1023465416 7:40449053-40449075 CAATAGCCACATGTGGCTAGTGG - Intronic
1024068424 7:45765311-45765333 CAACAGCCACATGTGGCAAGTGG - Intergenic
1024451207 7:49545524-49545546 CAAGAACCACATGTGGTGGGAGG - Intergenic
1025628750 7:63247805-63247827 CAACAGCCACATGTGGCAAGTGG - Intergenic
1026093620 7:67322664-67322686 CAATAGCCACATGTGGTCAGGGG - Intergenic
1026422011 7:70249359-70249381 CAAAAGCCACATGTGGCCAGTGG + Intronic
1026869796 7:73843316-73843338 AAATAGCCACATGTGGCTAGTGG + Intergenic
1027434384 7:78149162-78149184 CCACAGCCACATGTGGCTAATGG + Intronic
1027437915 7:78185294-78185316 CAATAGCCACATGTAGCTAGTGG + Intronic
1027525500 7:79264183-79264205 CATTAGCCACATGTGGTTTGTGG + Intronic
1028006281 7:85572714-85572736 CAATAGCGACATGTGGCTAGTGG - Intergenic
1028420457 7:90627176-90627198 CATTAGCCACATGTGGCTAGTGG + Intronic
1028460837 7:91090398-91090420 CAATAGCCACACGTGGCTAGTGG - Intronic
1028480114 7:91295098-91295120 CAGAAGGCACATGTGGTGAGGGG + Intergenic
1028965012 7:96792335-96792357 CAGTAGCCACTTGTGGTTAGTGG - Intergenic
1028971373 7:96862437-96862459 CAATAGCCACATGAGGTTGGTGG - Intergenic
1029019394 7:97348346-97348368 GCATAGGCAGATGTGGTCAGGGG - Intergenic
1029043249 7:97599604-97599626 CAATAGCCACATATGGCTAGTGG - Intergenic
1029093716 7:98068623-98068645 AAATAGCCACATGTGGCTAGTGG - Intergenic
1029255203 7:99264969-99264991 ACTCAGCCACATGTGGTTAGCGG - Intergenic
1029310780 7:99661852-99661874 AAATAGCCACATGTGGATAGTGG - Intronic
1029928930 7:104350146-104350168 AAATAGCCACATGTGGTGACAGG - Intronic
1030849338 7:114463382-114463404 CAGTAGCCACATGTGGATAGTGG - Intronic
1030858482 7:114591887-114591909 CAATAGCCACATATGGCTAGTGG - Intronic
1031003145 7:116441009-116441031 CAATAGCCACATGTGGCTAGTGG + Intronic
1031017476 7:116591340-116591362 CAGTAGCCACATGTGGCTAGTGG + Intergenic
1031218501 7:118930320-118930342 CAATAGTCACATGTGGTTATTGG - Intergenic
1031675521 7:124607032-124607054 ATATAGCCACATGTGGCTAGTGG - Intergenic
1031735578 7:125356026-125356048 TAATACTCACATGTGGTGAGAGG + Intergenic
1032249464 7:130242236-130242258 CCATAGCCACAAGTGGCTGGTGG + Intergenic
1032288433 7:130562918-130562940 TCACAGCCACATGTGGTCAGTGG - Intronic
1032334767 7:131015378-131015400 CCATGGCCACATGTGGCTGGTGG - Intergenic
1032344031 7:131103319-131103341 CAATAGCCACAAGTGGCTAGTGG + Intergenic
1032434556 7:131889445-131889467 CCATGGCCACATGTGGCTAGTGG + Intergenic
1032445373 7:131977966-131977988 CAATAGCCACATGTGGGTAGTGG + Intergenic
1032590541 7:133188064-133188086 TCATAGCCACATGCAGTGAAAGG + Intergenic
1032732356 7:134656259-134656281 CCATAGCCACATGTGACCAGTGG - Intronic
1033525501 7:142209812-142209834 CAATAGCCACATGTGGCTAGTGG - Intronic
1033785116 7:144720932-144720954 CAGTGGCCACATGTGGTTAGAGG - Intronic
1033812928 7:145038246-145038268 CCATCGTCACATGTGGTTTGCGG - Intergenic
1033973352 7:147069823-147069845 CCATAGCTACATATGGCTAGTGG - Intronic
1034348513 7:150401758-150401780 CAATAGCCATATGTGGCTAGTGG - Intronic
1034458186 7:151183061-151183083 CGATAGCCACAGGTGGCTAGTGG - Intronic
1034466159 7:151230463-151230485 CCATAGCCACATATGGCCGGAGG - Intergenic
1035193188 7:157190494-157190516 CAGTAGCCACATGTGGCCAGGGG + Intronic
1035298965 7:157884803-157884825 CAATTGCCACATGTCGTGAGAGG - Intronic
1035363577 7:158329893-158329915 CCATAGCTACATGGAGTGACTGG + Intronic
1035583980 8:758069-758091 CAACAGCCACATATGGTAAGTGG - Intergenic
1036607916 8:10324144-10324166 CAACAGCCACATGTGGCCAGAGG - Intronic
1036915932 8:12803640-12803662 CAATAGCCACATGTGGCCAGTGG - Intergenic
1037238265 8:16747471-16747493 CAGTAGCCACATGTGATGAGTGG + Intergenic
1037273061 8:17151180-17151202 CAATAGCCACATGTGGCTAGTGG - Intergenic
1037420541 8:18697231-18697253 CGACAGCGACATGGGGTGAGTGG + Intronic
1037881010 8:22573522-22573544 CAACAGCCACAGGTGGCGAGTGG + Intronic
1038029049 8:23621093-23621115 CCATAGGCACAGCTGGGGAGAGG - Intergenic
1038994899 8:32910965-32910987 CAATAGCCACATGTGGCTAGTGG - Intergenic
1039105900 8:33989293-33989315 CCAAAGCCACGTGTGATAAGTGG + Intergenic
1039150907 8:34504492-34504514 CCAAAACCAAGTGTGGTGAGGGG + Intergenic
1041037362 8:53807891-53807913 CCAGAACCACATATGGTTAGGGG + Intronic
1041436103 8:57843523-57843545 CCACAGCCACTTATGTTGAGAGG + Intergenic
1041695895 8:60735862-60735884 CAAAAGCCACATGTGGTTGGTGG - Intronic
1041778754 8:61554607-61554629 CAATGGCCACATGTGGCCAGTGG + Intronic
1042144839 8:65716922-65716944 CAATATCCACATGTGGCTAGTGG - Intronic
1042235195 8:66605257-66605279 CAATAGCCACATGTGGCTAATGG + Intronic
1042688091 8:71463173-71463195 CAATAGCCACATGTGGCTAGTGG + Intronic
1042881484 8:73496853-73496875 CAATAGCCACATGTGGCTAATGG + Intronic
1043384862 8:79738201-79738223 GAATAGCCACATGTGGCTAGTGG - Intergenic
1043384868 8:79738287-79738309 CCATAGCCACATGTGGCTAGTGG + Intergenic
1043515007 8:80987990-80988012 CAATAGCCACATGTGGCCAGTGG + Intronic
1043719207 8:83524737-83524759 CCATAGCCACTTGTGGCTAGTGG - Intergenic
1044035445 8:87297376-87297398 CAATAGCTACATGTGGCTAGCGG + Intronic
1044208900 8:89526105-89526127 AAATAGCCACATGTGGTTAGTGG + Intergenic
1044246589 8:89954547-89954569 ACAAAACCACATTTGGTGAGAGG + Intronic
1044526458 8:93257369-93257391 AAATAGTCACATGTGGTTAGTGG + Intergenic
1044768920 8:95608647-95608669 TAATAGCCACATGTGGTTAGTGG + Intergenic
1044781205 8:95745204-95745226 ACTTAGCCACATGTGATTAGTGG + Intergenic
1044837275 8:96308582-96308604 CAATAGCCACACGTGGTGAGTGG - Intronic
1044890651 8:96831949-96831971 CAATAGCCACATGTGGCTAATGG + Intronic
1044966930 8:97582824-97582846 AAATAGCCACATGTGGTTAATGG - Intergenic
1045049624 8:98311019-98311041 CAATAGCCACATGTGTCTAGTGG + Intergenic
1045127639 8:99110527-99110549 CAACAGCCACATGTGGCTAGTGG - Intronic
1045769718 8:105721870-105721892 CCATAGCCACAAGTGGCAAGTGG - Intronic
1045897382 8:107235971-107235993 CAATAGCCATATGTGGCTAGTGG + Intergenic
1046378117 8:113414156-113414178 CAATAGCTACATGTGGCCAGTGG - Intronic
1046500883 8:115075016-115075038 CAATAACCACATGTGGTTAGTGG + Intergenic
1046555375 8:115767845-115767867 CCATAGCCACATGTAGCCATTGG + Intronic
1046726507 8:117680572-117680594 CAATAACCACATGTGATTAGTGG - Intergenic
1046794363 8:118354647-118354669 CAATAGCCACATGTCATTAGTGG + Intronic
1047616463 8:126566461-126566483 CAATAGCCACATGTGACCAGCGG - Intergenic
1047742919 8:127821269-127821291 CAATAGCCACATGCGGCTAGTGG - Intergenic
1048197158 8:132341033-132341055 CAATAGTCACATGTGGTTGGTGG + Intronic
1048239636 8:132728465-132728487 CAATTCCCACATGTTGTGAGAGG - Intronic
1048512345 8:135074310-135074332 CAGTAGCCACATGTGGCCAGTGG + Intergenic
1048892464 8:138959981-138960003 CAATAGCCACATGTGGCTAGTGG - Intergenic
1049098489 8:140562759-140562781 CCATAGCCACATGTGGCTAGTGG - Intronic
1049144233 8:140986148-140986170 CATTAGCCACATGTGGCTAGTGG - Intronic
1049355068 8:142183455-142183477 CCTGAGCCACAGGTGGTGGGAGG - Intergenic
1049905530 9:213658-213680 CAATAGCCACATGTGGCTAGTGG + Exonic
1050164539 9:2750256-2750278 CAATTCCCACATGTTGTGAGAGG + Intronic
1050733769 9:8739491-8739513 ACACAGCCACATGTGGCTAGTGG + Intronic
1051062688 9:13063034-13063056 AAATAGCCACATGTGGCTAGTGG + Intergenic
1051313989 9:15809306-15809328 CAATAGCCACACGTGGCTAGTGG - Intronic
1051396031 9:16621705-16621727 CAATACCCACATGTGGCTAGTGG - Intronic
1052040226 9:23729953-23729975 CTATAGCCTGAAGTGGTGAGGGG - Intronic
1053277282 9:36792999-36793021 GAATAGCCACATGTAGTTAGTGG - Intergenic
1053563192 9:39217885-39217907 ACATTCCCAGATGTGGTGAGGGG + Intronic
1053828977 9:42055801-42055823 ACATTCCCAGATGTGGTGAGGGG + Intronic
1054133955 9:61401194-61401216 ACATTCCCAGATGTGGTGAGGGG - Intergenic
1054601582 9:67131634-67131656 ACATTCCCAGATGTGGTGAGGGG - Intergenic
1054784131 9:69194577-69194599 CAGTAGCCACATGTGGCTAGTGG + Intronic
1054841094 9:69741025-69741047 CAATAGCCACATGTGGCTAATGG + Intronic
1055234085 9:74098807-74098829 AAATAGCCACATGTGGCTAGTGG + Intergenic
1055312881 9:75002423-75002445 CAGTAGCCACATGTAGTTAGTGG - Intronic
1055507314 9:76961641-76961663 AAATAGTCACATGTGGTTAGTGG + Intergenic
1055662560 9:78519882-78519904 CCATAGCCACTGCTGTTGAGGGG + Intergenic
1055711723 9:79070247-79070269 CAATAGCCATATGTGGCCAGTGG - Intergenic
1055747124 9:79460716-79460738 CAATAGCCACGTGTGGCTAGTGG - Intergenic
1056099772 9:83290207-83290229 CAATAGCCACATGTGGCTGGTGG - Intronic
1056279507 9:85027590-85027612 CACTAGCCACATGTGGGTAGAGG - Intergenic
1056528841 9:87469179-87469201 TAATAGTCACATGTGATGAGAGG - Intergenic
1056872811 9:90300760-90300782 CCATGGACACTTGTGGGGAGAGG - Intergenic
1057615625 9:96587305-96587327 CCACTGCCACATGTGGGTAGTGG + Intronic
1057921564 9:99102652-99102674 CCAGACCCACATCTAGTGAGTGG + Intergenic
1057933737 9:99219300-99219322 CAACAGCCACATGTGGCTAGTGG + Intronic
1057978913 9:99638126-99638148 CAATAGCCACATGTGGCCAGTGG - Intergenic
1058657695 9:107238871-107238893 CAGTAGCCACATGTGGTTAATGG - Intergenic
1058805214 9:108583894-108583916 CAATAGCCAGATGTGGTGAATGG - Intergenic
1058819039 9:108712297-108712319 GGATAACCACAGGTGGTGAGGGG - Intergenic
1059767146 9:117394400-117394422 CAATAGCCACATATGGCTAGTGG + Intronic
1060075701 9:120588903-120588925 CAATAGCCACAAGTGGCTAGTGG - Intergenic
1060390833 9:123275326-123275348 CCATAGCCGCATGTGGCTAGTGG + Intergenic
1060399085 9:123337284-123337306 CAACAGCCACATGTGGCCAGAGG - Intergenic
1060862824 9:126969454-126969476 CAGTAGCCACATGTGGCTAGTGG + Intronic
1061505156 9:131027657-131027679 ACTTAGCCACATGTGGCCAGTGG + Intronic
1203522927 Un_GL000213v1:60561-60583 CAATAGCCACATGTGGCTAGTGG - Intergenic
1185973000 X:4685502-4685524 GAATAGCCCCATGTGGTTAGTGG + Intergenic
1186080517 X:5926033-5926055 CCATGGCCACATGTTGTGGGAGG + Intronic
1186082651 X:5950204-5950226 CAATAGCCACATGTGGTTATTGG - Intronic
1186169730 X:6864037-6864059 CCATAGCCACATGTAGTGAGTGG + Intergenic
1186362771 X:8859899-8859921 CCACAGCCACATATGGCTAGTGG - Intergenic
1186430715 X:9502012-9502034 CCACAGCCACATGTGGCGCATGG - Intronic
1186438374 X:9563683-9563705 CAGTAGCCACATGTGGCCAGTGG + Intronic
1186479791 X:9887921-9887943 CAATGGCCACATGTGGGTAGTGG - Intronic
1186798639 X:13070842-13070864 CAGTAGCCACATGTGGCTAGTGG - Intergenic
1186830516 X:13385344-13385366 AAATAGCCACATGTGTTTAGTGG - Intergenic
1186841336 X:13487467-13487489 CCATGACCACATGTGGTGATGGG + Intergenic
1186858748 X:13650439-13650461 CAATAGCCACCTGTGGCTAGTGG - Intergenic
1186863695 X:13698033-13698055 CAGTAGCCACATGTGATTAGTGG + Intronic
1186966211 X:14788758-14788780 CAAGAGCCACATGTGGCCAGTGG + Intergenic
1187026353 X:15439211-15439233 CAATAGCCACATGCAGTGAGTGG - Intronic
1187094197 X:16129311-16129333 AAATAGCCACATGTGGTTAGTGG - Intronic
1187094204 X:16129404-16129426 CAGTAGCCACATGTGGCTAGTGG + Intronic
1187286326 X:17907425-17907447 CAATAGACACATGTGGCTAGTGG - Intergenic
1187300742 X:18047163-18047185 CAATAGCCATATGTGGCTAGTGG + Intergenic
1187531782 X:20103728-20103750 CAACAGCCACATGTGGCTAGTGG + Intronic
1187556365 X:20356156-20356178 TAATAGCCACATGTGGCTAGTGG - Intergenic
1187696357 X:21925304-21925326 CTGTAGCCACATGTGGCTAGAGG - Intergenic
1187782840 X:22847749-22847771 CGATAGCCACATATGGCAAGTGG - Intergenic
1187941826 X:24390073-24390095 AAATAGCCACATGTGGTTAGTGG + Intergenic
1188322355 X:28755352-28755374 ACACAGCCACATGTGGCTAGTGG - Intronic
1188343097 X:29029201-29029223 CCATCCCCACATGTCGTGGGAGG - Intronic
1188483959 X:30662085-30662107 CAGTAGCCACATGTGGCCAGTGG - Intronic
1188487241 X:30695813-30695835 CAATAGCCAAATGTGGCTAGTGG - Intronic
1188595244 X:31892367-31892389 CAATAGCTACATGTGGTTAGTGG - Intronic
1188680716 X:33000584-33000606 CCAAAGCCACATGTGGCTAGTGG - Intronic
1188871339 X:35377015-35377037 CAATAGCCACATGTGACTAGTGG + Intergenic
1188914945 X:35898882-35898904 AAATAGCCACATGTGGCTAGTGG + Intergenic
1189075354 X:37908648-37908670 CCATATACCCATGTGGAGAGGGG - Intronic
1189115906 X:38342435-38342457 CCATTGGCACATGTGGTGAGAGG - Intronic
1189123095 X:38415933-38415955 CAATAGCCACATGTGGCTGGTGG + Intronic
1189222869 X:39387845-39387867 CAATAGCCATGTGTGATGAGTGG + Intergenic
1189256461 X:39643533-39643555 CAGTAGCCACATGTGGCTAGTGG + Intergenic
1189368809 X:40411655-40411677 CAATACCCACATGTGGCTAGTGG - Intergenic
1189387905 X:40552321-40552343 TGATAGCCACATGTGGCTAGTGG + Intergenic
1189579032 X:42386301-42386323 AAATAGCCACATGTGGCTAGCGG + Intergenic
1189965104 X:46364672-46364694 CAGTAGCCACATGTGGTTACTGG + Intergenic
1190120117 X:47652080-47652102 CCATATCCACATGTTGCTAGAGG - Exonic
1190421651 X:50290727-50290749 CCATATCCCCATGGGGTTAGGGG + Intronic
1190731650 X:53230454-53230476 CAGTAGCCACATGTGGCTAGTGG + Intergenic
1190826523 X:54022994-54023016 CAGCAGCCACATGTGGTTAGGGG + Intronic
1190909785 X:54760236-54760258 CAATAGCCACATGTTGCCAGTGG + Intronic
1191011604 X:55765437-55765459 CAATAGCCACATGTGCTGAGTGG - Intergenic
1192407835 X:70904689-70904711 CAATAGTCACATGTGGCTAGTGG - Intronic
1192588177 X:72337276-72337298 CAATAGCCACATGTGACTAGTGG - Intronic
1192588180 X:72337363-72337385 ACTTAGCCACATGTGGCTAGTGG + Intronic
1192902003 X:75509425-75509447 TAATAGCCACATGTGGCTAGTGG + Intronic
1193459860 X:81777050-81777072 CAATTCCCACATGTTGTGAGAGG - Intergenic
1193648306 X:84095480-84095502 TAATAGCCACATGTGGCCAGTGG - Intronic
1193737686 X:85179059-85179081 CAATAGCCACATGTGCCTAGTGG - Intergenic
1193737691 X:85179164-85179186 AAATAGCCACATGTGGCTAGTGG + Intergenic
1194267659 X:91775393-91775415 CAGTAGCCACATGTGGATAGTGG + Intergenic
1194272710 X:91837912-91837934 TAATAGCCACATGTGGTTAGTGG + Intronic
1194807957 X:98353148-98353170 CAATAGCCACATGTGGCTAGTGG - Intergenic
1195454087 X:105048859-105048881 CAATAACCACATGTGGCTAGTGG + Intronic
1195652383 X:107298658-107298680 CAATAGCCACATGTGGCTAGTGG + Intergenic
1195843485 X:109201001-109201023 CTATAGCCACATGTGACCAGTGG + Intergenic
1196147626 X:112336680-112336702 CAATAGCCACACGTGGCTAGTGG + Intergenic
1196551764 X:117036447-117036469 CAGTAGCCACATGTGGCTAGTGG + Intergenic
1196684797 X:118501543-118501565 CAATAGCCACATGTGGCTAGTGG + Intronic
1196695353 X:118606022-118606044 CAATAGCCACATGTGGCTGGTGG - Intronic
1196944563 X:120811156-120811178 CCAGATCTACATGTGGAGAGAGG + Intergenic
1197292566 X:124676961-124676983 CAACAGACACATGTGATGAGTGG - Intronic
1197312445 X:124921769-124921791 CAATAGTCACATGTGGCTAGTGG - Intronic
1197704064 X:129621381-129621403 CCATAGCCACATGTGGCTCATGG + Intergenic
1197799489 X:130334716-130334738 CAATAACCACATGTGGTGAGTGG - Intergenic
1197804208 X:130383837-130383859 CAGTAGCCACATGTGGCTAGTGG - Intergenic
1197852769 X:130881174-130881196 CAATAGCCACATGTGGCTAGTGG + Intronic
1198315660 X:135463750-135463772 CAGGAGCCACATGTGGTGAGTGG - Intergenic
1198575913 X:138010088-138010110 CAATAGCCACATGTGACTAGTGG + Intergenic
1198703707 X:139424138-139424160 CAATAGCCACATGTGGCTAGTGG + Intergenic
1198996221 X:142577233-142577255 CAATTCCCACATGTGGTGGGAGG + Intergenic
1199295038 X:146147375-146147397 CCATAGGCACATGTGGCTAGTGG - Intergenic
1199584338 X:149397777-149397799 CAATAGCCACATGTAGCTAGTGG - Intergenic
1199975360 X:152891973-152891995 CAATAGCCCCATGTGGCCAGTGG - Intergenic
1199975368 X:152892070-152892092 AAATAGCCACATGTGGCCAGTGG + Intergenic
1200584867 Y:4996324-4996346 CAGTAGCCACATGTGGGTAGTGG + Intergenic
1200836384 Y:7736125-7736147 AAATAGCCACATGTGGCTAGTGG - Intergenic
1201560083 Y:15306607-15306629 CCATACCCACATGCAGTGAGTGG + Intergenic
1202031614 Y:20580854-20580876 ACATAGTCACATGCGGTTAGTGG - Intronic
1202380276 Y:24270888-24270910 CCACAGTAACATGTGGAGAGAGG + Intergenic
1202490507 Y:25399237-25399259 CCACAGTAACATGTGGAGAGAGG - Intergenic